Гены и геномы Т1 (Сингер М., Берг П., 1998)

Доступен только на studygur

Тема:
Скачиваний: 13
Страниц: 377
Опубликован:
ЧИТАЙТЕ ПОЛНЫЙ ТЕКСТ ДОКУМЕНТА

ПРЕДПРОСМОТР

ГЕНЫ И ГЕНОМЫ
GENES & GENOMES
A changing Perspective
Maxine Singer
President, Carnegie Institution of
Washington Scientist Emeritus,
National Institutes of Health
Paul Berg
Willson Professor of Biochemistry
Director, Beckman Center for Molecular
and Genetic Medicine,
Stanford University School of Medicine
University Science Books
Mill Valley, California
М.СИНГЕР, П.БЕРГ
В двух томах
Том 1
Перевод с английского
д-ра биол. наук Т.С. Ильиной
д-ра биол. наук Ю.М. Романовой
под редакцией
д-ра биол. наук Н.К. Янковского
МОСКВА «МИР» 1998
УДК 575.113/118
ББК 28.04
С38
С38
Авторы: Сингер М., Берг П.
Гены и геномы: В 2-х т. Т. 1. Пер. с англ. М.: Мир,
1998.– 373 с., ил.
ISBN 5-03-002849-8
Университетское руководство по молекулярной биологии, написанное
выдающимися американскими учеными, членами Национальной академии
наук (П. Берг - лауреат Нобелевской премии). Книгу отличают общебиологический подход, глубина теоретических обобщений, изящная и наглядная форма подачи материала.
В 1-м томе рассматриваются следующие вопросы: строение и функционирование биологических молекул, участвующих в работе генетического аппарата; процессы репликации и экспрессии генов; широкий круг
вопросов, относящихся к технологии рекомбинантных ДНК (ферментные
системы, системы вектор–хозяин, манипуляции с рекомбинантными ДНК).
Для молекулярных биологов, преподавателей и студентов университетов, специалистов.
ББК 28.04
Редакция литературы по биологии
Издание осуществлено при поддержке
Российского фонда фундаментальных исследований
по проекту № 98-04-62107
ISBN 5-03-002848-Х (русск.)
ISBN 5-03-002849-8
ISBN 0-935702-17-2 (англ.)
© 1991 by University Science Books
© перевод на русский язык издательство
«Мир», 1998
ОТ РЕДАКТОРА
ПЕРЕВОДА
Книга «Гены и геномы» отличается сочетанием
традиционных разделов молекулярной генетики,
таких, как молекулярные основы наследственности,
технология рекомбинантных ДНК, анатомия, экспрессия и регуляция генов, с новым взглядом на
молекулярно-генетические
проблемы – рассмотрением их в контексте организации и функционирования целых геномов.
Авторы книги М. Сингер и лауреат Нобелевской
премии по химии П. Берг – всемирно известные специалисты в области молекулярной биологии, одни
из создателей генной инженерии, методической основы современной молекулярной биологии и генетики. Читатель найдет в книге подробные сведения
о структуре и функциях ДНК, РНК, белков; репликации и функционировании генома, обратной транскрипции; модификациях, репарации и рекомбинации
ДНК; о транскрипции и трансляции мРНК в клетках
про- и эукариот; регуляции экспрессии генов; технологии рекомбинантных ДНК. Все эти вопросы обсуждаются в первых двух частях книги.
Особый интерес для нашего читателя представляет описание молекулярной анатомии эукариотических геномов, интегрирующее современные молекулярно-биологические знания в данной области
(часть III), поскольку в отечественной литературе
информация по этим проблемам носит фрагментарный характер. Авторы анализируют структуру
и функции генома как целого и роль геномных
перестроек в функционировании генома в норме и
патологии, подчиняя этой задаче рассмотрение его
элементов (тандемных и диспергированных повторов, центромерных и теломерных областей, транспозонов и др.). В заключительной, четвертой части
обсуждаются принципы функционирования и перспективы дальнейших исследований сложных биологических систем (мультигенные семейства, тканеспецифичная экспрессия, эмбриональное развитие
и дифференцировка).
Каждой части предшествует краткий обзор общих принципов и концепций рассматриваемых в
этом разделе вопросов молекулярной генетики; за
ним следует углубленное описание экспериментальных работ, на основе которых эти концепции были
сформулированы. Завершаются части списком первоисточников по ключевым экспериментальным работам данного направления.
Книга может служить руководством для подготовки студентов и аспирантов на биологических
и медицинских факультетах вузов, а также поможет
научным работникам ориентироваться в новых областях исследования, связанных с изучением геномов. Понимание текста облегчают многочисленные
оригинальные иллюстрации и таблицы. Они будут
также полезны преподавателям вузов в качестве
иллюстративного материала при чтении лекций.
Издание русского перевода книги «Гены и геномы» особенно своевременно, поскольку развитие
современной молекулярной биологии идет во многом через исследования структуры и функций геномов, проводимые в рамках всемирной программы
«Геном человека».
Книгу переводили: Т.С. Ильина (введение к ч. II,
гл. 4–7), Е.А. Кабанова (введение к ч. III, гл. 8),
А.А. Лушникова (гл. 9, 10, ч. III), Ю.М. Романова
(предисловие, благодарности, введение к ч. I, гл. 1–3).
Н.К. Янковский
ПРЕДИСЛОВИЕ
Эта книга посвящена молекулярным структурам
и механизмам, лежащим в основе передачи и
использования генетической информации сложными
организмами. Представляя ее, мы надеемся, что
у читателя возникнет чувство предвкушения того
удовольствия, которое он получит, знакомясь с
открытиями в области рекомбинантных ДНК.
Чтобы подготовить читателя к восприятию этих
новейших достижений, мы остановились во введении к гл. 1–3 на классических генетических и биохимических исследованиях, проведенных в период
с начала века до примерно 1972 г. Эти исследования
были выполнены преимущественно на микроорганизмах, и благодаря им удалось установить структуру и функции генов и геномов. Разработка в начале 70-х годов методов получения рекомбинантных
ДНК и связанный с этим прогресс в технологии
быстрого определения нуклеотидной последовательности ДНК позволили вскоре применить молекулярные методы и для исследования более сложных геномов. Ядро книги составляют работы,
выполненные менее чем за два десятилетия, которые
показали, какие широкие возможности дает использование этих методов в биологии.
Книга создавалась довольно долго. Идея ее написания возникла после того, как один из нас (П. Б.)
прочел серию публичных лекций в университете
Питтсбурга в 1979 г. Попытка подготовить публикацию лекций показала несостоятельность этого
замысла. Когда такие лекции читаются в аудитории
слушателей, не являющихся биологами, приходится
опускать многие интересные детали, и книга, лишенная таких тонкостей, конечно, не может принести удовлетворения. По мере расширения концептуальной основы книги становилась очевидной
необходимось разделить тяжкий труд по ее написанию с кем-нибудь еще. Так нас стало двое. Мы
вместе прорабатывали весь материал, пытаясь добиться унифицированного, согласованного подхода
и стиля. Мы поняли всю безрассудность попытки
дать всестороннее, всеобъемлющее изложение материала; эта задача была успешно решена до нас
большими группами авторов в нескольких недавних
блестящих изданиях. Нам приходилось постоянно
пересматривать уже написанные главы, чтобы их
окончательный вариант соответствовал последующим разделам, еще находящимся в работе. Чтобы
нас не захлестнул поток постоянно поступающей
новой информации, мы ограничили наши задачи,
сосредоточив внимание на тех проблемах, которые
уже довольно глубоко изучены и наглядно иллюстрируют достигнутый прогресс.
Наша главная задача состояла в том, чтобы
раскрыть сущность и глубину экспериментальных
подходов науки, которая была названа молекулярной генетикой, применительно к эукариотическим
организмам. Чтобы решить эту задачу, а также
облегчить понимание материала читателями, обладающими ограниченным объемом знаний по
биохимии, клеточной биологии и генетике, мы постарались изложить основы этих направлений биологии двумя способами. Во-первых, в гл. 1, 2 и 3
суммирована наиболее важная информация о структуре ДНК, РНК и белков; о различных клеточных
процессах, протекающих с участием ДНК (репликация, репарация и рекомбинация); об основных
механизмах транскрипции, трансляции и контроле
экспрессии генов. Читатели, хорошо ориентирующиеся в данных вопросах, могут пропустить эти
главы. Во-вторых, во введениях к частям I, II и III
даны исторические экскурсы и общий взгляд на
проблемы, изложенные в главах, составляющих эти
части. В них не говорится детально о том, как были
открыты и доказаны те или иные положения, а делается попытка объяснить, как на основе различных
исследований в области биохимии, генетики, микробиологии, клеточной и эволюционной биологии
был выстроен интеллектуальный каркас современной биологии. Так, во введении, предваряющем гл. 1, 2 и 3, прослеживается исторический путь,
приведший нас к современному взгляду на наследственность. Мы знакомимся с концепцией гена,
трансмиссией и сегрегацией генов, с логическим
переходом от первичного картирования генетических детерминант к точной локализации генов на
хромосоме, с идентификацией генов как дискретных
участков молекулы дезоксирибонуклеиновой кислоты и информационными взаимоотношениями
между ДНК, РНК и белками.
В части II (гл. 4–7) описаны подходы к конструированию рекомбинантных молекул ДНК, их
клонированию, отбору и характеристике, а также
другие экспериментальные методы, использующиеся в молекулярной генетике. Основное внимание
уделяется принципам этих методов, а не лабораторным приемам. Читатели, которых больше интересуют методические детали, могут обратиться
к замечательным сборникам, вышедшим за послед-
ПРЕДИСЛОВИЕ
ние 10 лет; ссылки на них даны в книге. Во введении,
предваряющем гл. 4–7, особое внимание уделяется истории развития современных подходов
и методов, разработанных на основе огромного
количества казалось бы не связанных между собой
фундаментальных исследований в энзимологии,
генетике бактерий и бактериофагов и биохимии
нуклеиновых кислот.
Основная тема книги раскрывается в части III,
где изложены концепции, лежащие в основе наших
представлений о генетических информационных
системах эукариот. Введение к этой части знакомит
нас с отличительными особенностями геномов
эукариот. Речь идет об интронах и сложных сигналах, регулирующих транскрипцию, а также о
множестве повторяющихся последовательностей в
геноме и связанной с этим ролью обратной транскрипции в происхождении сегментов эукариотической ДНК. Раздел заканчивается описанием некой
объединяющей концепции, рассматривающей биологическую эволюцию как процесс, в основе которого лежит перестройка нуклеиновых кислот и,
следовательно, изменение структуры белковых
молекул.
В первой из трех глав части III (гл. 8) приведены данные о структуре генов эукариот и современные представления о механизме их экспрессии, в частности сведения о сложных сигналах регуляции транскрипции, а также о происхождении, локализации и структуре интронов и тех механизмах,
с помощью которых интроны удаляются из первичных транскриптов при сплайсинге. Очень существенным здесь явилось применение обратной
генетики – введение специфических мутаций в определенные сегменты ДНК и последующий анализ
структурно-функциональных взаимоотношений в
генах эукариот. В гл. 9 основное внимание сосредоточено на организации сложных эукариотических
геномов. Рассмотрено расположение генов и других
элементов в молекуле ДНК, в частности в центромерных и теломерных областях. Красной нитью
через всю главу проходит концепция генома как
летописи эволюционной истории. В заключение
дано описание геномов внутриклеточных органелл – митохондрий и хлоропластов. В гл. 10 представлены механизмы случайных и неслучайных
перестроек геномной ДНК. Речь идет об амплификациях, делециях и транспозициях – как незапрограммированных и приводящих к мутагенезу,
так и запрограммированных в геноме и осуществляющих точную регуляцию генной экспрессии, например изменение типов спаривания у дрожжей
и образование генов иммуноглобулинов.
В части IV дана краткая иллюстрация
применения
общих
принципов,
рассмотренных ранее, к специфическим сложным биоло-
7
гическим системам. Показано, что гены работают в составе сложных многокомпонентных
взаимодействующих систем. В каждой из таких
систем указанные общие принципы используются
по-своему, что приводит к огромному разнообразию живого. Ранее это разнообразие описывалось чисто феноменологически. Теперь феноменологическое описание уступает место описанию регуляции генной экспрессии во времени и
пространстве на молекулярном уровне. В этой части
рассматривается также, как с развитием методологии рекомбинантных ДНК биология превратилась из науки описательной в практическую. Генотипы, а следовательно, и фенотипы на уровне индивидуальных белков, клеток и организмов можно
изменять, что позволяет в будущем исследовать
фундаментальные биологические процессы, а также
решить острые вопросы, стоящие перед человечеством и планетой, которую мы населяем. Многие
из предоставляющихся возможностей можно будет
реализовать только после того, как мы лучше узнаем структуру геномов. Это касается определения
точного расположения генов и получения более
полной информации об их нуклеотидных последовательностях. В части IV излагаются также положения, существенные для картирования и секвенирования геномов некоторых видов, в том числе
и человека.
В 1980 г., когда нам впервые пришла мысль
о написании книги, мы, как и многие другие биологи, только что пережили период, когда научные
издания стали привлекать к себе столь же пристальное внимание, как и общественно-политические.
Ошеломляющие успехи, достигнутые благодаря
применению методологии рекомбинантных ДНК,
были только одним из аспектов того, что называли
«революцией в биологии». Наряду с приходом новой эры в постижении сути живого эта революция
вызвала беспрецедентное беспокойство общественности о последствиях биологических экспериментов.
Вначале общественный интерес был связан с тем,
что группа ученых-биологов подняла вопрос о безопасности экспериментов с рекомбинантными ДНК.
Людей, работающих с патогенными микроорганизмами, тоже беспокоила безопасность проведения
лабораторных исследований. Подобная ситуация
уже возникала в 1971 г., когда во всем мире стали
широко использоваться вирусы, индуцирующие
образование опухолей у экспериментальных животных. Жизненный цикл этих вирусов отличался от
жизненного цикла более привычных вирусов (например, вирусов кори или полиомиелита), а некоторые из них, вероятно, могли индуцировать рак
у человека. Это заставляло обратить самое серьезное внимание на потенциальную опасность таких
вирусов для ученых и студентов. Аналогичные опа-
8
ПРЕДИСЛОВИЕ
сения высказывались и в связи с появлением методов получения рекомбинантных ДНК. Общая атмосфера озабоченности усугублялась глубоким
чувством социальной ответственности, возникшим
и окрепшим в Соединенных Штатах за предыдущее
десятилетие борьбы за гражданские права и против
войны во Вьетнаме.
Первые эксперименты по созданию рекомбинантной ДНК состояли в соединении ДНК, выделенной из вирусов, которые вызывали опухоли у
мелких лабораторных грызунов, с фрагментами
ДНК из хорошо изученных вирусов. Намерения
ввести эти новые молекулы ДНК в бактериальные
клетки вызвали серьезные нарекания, но вскоре
было принято решение приостановить подобные
попытки, и все страсти улеглись. Следующим крупным шагом было конструирование рекомбинантной
ДНК, содержащей ген, который обеспечивал устойчивость бактерий к антибиотикам. Возможность
генетической трансформации живых клеток путем
введения необычных молекул ДНК в бактерии поставила вопрос о том, что такие бактерии могут
вызывать развитие опухоли или приобретут резистентность к важным в медицинском отношении
антибиотикам. Эти вопросы обсуждались как на
научных конференциях, так и в частных беседах. На
одной из таких конференций в июне 1973 г. участвующие в ней ученые решили привлечь внимание
Национальной академии наук к этой перспективной
области исследований и попросить провести направленное исследование для оценки потенциальной
опасности манипуляций с рекомбинантными ДНК.
Чтобы придать гласность этому обращению, ученые
опубликовали письмо в журнале "Science".
Академия, как обычно, сформировала комитет,
куда вошли ученые, активно работающие с рекомбинантными ДНК и в смежных областях. Члены
комитета встретились в апреле 1974 г. и предложили два основных решения, ставших, к их удивлению, новостью номер один. Во-первых, они
призвали объявить всеобщий мораторий на те эксперименты с рекомбинантными ДНК, в которых
используется ДНК опухолеродных вирусов или в
бактерии вводятся гены, детерминирующие токсины
или ответственные за резистентность бактерий к
антибиотикам. Во-вторых, они призвали к широкому и свободному международному обсуждению
этих проблем на конференции, которую предполагалось провести следующей зимой.
Несмотря на ропот недовольства и даже обвинения в адрес ученых США в том, что они таким
образом пытаются затормозить работу ученых других стран и выиграть гонку в соревновании за
главные открытия, которые могут быть сделаны
благодаря развитию новых методов, мораторий,
насколько это известно, был принят повсеместно.
На конференцию были приглашены молекулярные
биологи, вирусологи, микробиологи и биохимики
США и других стран, а также представители научной администрации, журналисты и юристы.
Встреча состоялась в феврале 1975 г. в Асиломаре, шт. Калифорния, в конференц-центре на берегу Тихого океана, несколькими милями южнее
Гопкинсовской океанологической станции в Пасифик-Гроу (при Станфордском университете).
Организационный комитет провел предварительные
заседания рабочих групп, и эксперты в различных
областях подготовили документы для представления на конференции. Состоялась оживленная,
иногда жаркая, дискуссия о том, насколько реальна
опасность подобных экспериментов. Большинство
(но не все) участников признали, что риск появления особенно опасных организмов существует, но
вероятность этого очень мала. Принятие окончательного решения о дальнейших действиях было
отложено до тех пор, пока не скажут свое слово
юристы. Юристы же возложили персональную
юридическую ответственность за все последствия,
даже экстраординарные, на ученых. Они также напомнили нам, что общество должно быть застраховано от риска, если опасность последствий, пусть
крайне малая, существует. Позиции прояснились.
Необходимо было следовать именно этому основанному на здравом смысле курсу. В последний день
работы конференции был предложен предварительный отчет Организационного комитета. Он
всесторонне обсуждался и был в конце концов принят. Рекомендации Асиломарской конференции
получили широкую огласку в прессе и были опубликованы позже в ряде научных журналов. Несколькими неделями ранее к аналогичным заключениям пришел и возглавляемый лордом Эшби
правительственный комитет Великобритании.
Рекомендации, принятые в Асиломаре, стали
основой и импульсом для официальных мероприятий в США, начавшихся на следующий же день
после закрытия конференции. Комитет, организованный Национальными институтами здоровья
(НИЗ), приступил к разработке директив по контролю за всеми экспериментами с рекомбинантными
ДНК, проводимыми в институтах своего подчинения. Первые инструкции были весьма строгими в расчете на то, что по мере накопления опыта
и знаний они будут пересмотрены. По сей день не
выявлено ни одного нежелательного инцидента ни
с персоналом лабораторий, ни с кем-либо из других
людей, причиной которого были бы эксперименты,
проведенные с рекомбинантными ДНК; а таких
экспериментов насчитывается десятки тысяч. Содержащиеся в документе требования к большинству
рутинных экспериментов с рекомбинантной ДНК
изъяты или сделаны менее строгими. Жесткие тре-
ПРЕДИСЛОВИЕ
бования, согласно рекомендациям НИЗ, сохраняются только к тем экспериментам, в которых
рекомбинантная ДНК содержит протяженные
участки, полученные из ДНК особо патогенных
микроорганизмов (этих рекомендаций придерживаются и во многих других странах). Интересно
отметить, что использование технологии рекомбинантных ДНК сделало изучение некоторых важных, но опасных возбудителей инфекционных заболеваний человека и животных вполне доступным
и безопасным.
Интерес общественности к экспериментам с
рекомбинантными ДНК сохраняется по сей день
и теперь распространяется также на генную инженерию целых организмов – бактерий, растений и
животных. Сначала этот интерес и беспокойство
были сосредоточены на том же, на чем основывались интерес и беспокойство большинства ученых –
на возможности создания в эксперименте болезнетворных агентов. Местные власти и государственные органы издавали законы и указы, аналогичные рекомендациям НИЗ или даже более строгие. В конгрессе обсуждались предложения о придании рекомендациям НИЗ силы закона и установлении наказания за их несоблюдение, но ни одно
из них не было принято. Огромное количество
независимых дебатов – в разных местах и на разных
уровнях – в конце концов узаконили причастность
НИЗ к данной проблеме как в том, что касается
оценки риска, так и в смысле административной
организации.
Позже дискуссии приняли несколько иной характер. Некоторых ученых волнует вопрос о возможных эволюционных последствиях проникновения ДНК через видовые барьеры, например введение ДНК человека в клетки бактерий. Эти же
вопросы задают и люди, не являющиеся учеными,
однако данный аспект признан не заслуживающим
большого внимания. В природе возникает неимоверное число возможностей для обменов ДНК подобного рода, и, по-видимому, они действительно
происходят. Эксперименты с рекомбинантными
ДНК лишь ненамного увеличивают их вероятность.
Кроме того, большинство организмов, несущих
рекомбинантные молекулы ДНК, мало жизнеспособны вне лаборатории. Этот последний довод
приводился и при недавнем обсуждении вопросов,
связанных с необходимостью правительственного
контроля за преднамеренным распространением в
окружающей среде важных в сельскохозяйственном
отношении организмов, полученных методом генной инженерии. Конечно, подобные проблемы требуют внимания, но предъявление слишком строгих
требований (например, использование защитной
одежды, подобной костюму астронавта) с научной
точки зрения необоснованно.
9
Постоянно обсуждается вопрос и о возможности применения техники рекомбинантной ДНК
для создания биологического оружия. США присоединились к международной конвенции 1972 г.,
запрещающей проведение подобных работ, а Министерство обороны продолжает финансировать
исследования по защите от биологического оружия,
которое может быть создано в других странах. Это
направление тоже интенсивно обсуждается, поскольку трудно определить грань, разделяющую
работы, которые направлены на создание средств
нападения и защиты. Такие проблемы одинаково
волнуют как ученых, так и людей, не имеющих
отношения к науке, поскольку они носят политический и социальный характер, а не чисто научный,
как и другие проблемы, связанные с развитием
новых направлений биологии. Что принесет человечеству генная терапия, если станет возможным ее
применение,– пользу или вред? Как справиться
обществу и отдельным гражданам с растущим потоком информации о человеческих генах, которые
могут быть приобретены в результате применения
новых технологий? Каковы этические проблемы,
связанные с возможным введением генов человека
в организмы животных? Надо ли патентовать животных и растения, полученные с помощью генной
инженерии?
Озабоченность общественности, связанная с наступлением биологической революции, породила
негативное отношение к данным исследованиям.
Биологи опасались худшего: введения строгих правил или инструкций, которые могли серьезно помешать дальнейшей экспериментальной работе и,
следовательно, не позволили бы получить новые
многообещающие результаты и внедрить их в медицину, сельское хозяйство и промышленность.
Многие ученые выражали сожаление о прекращении
свободных дискуссий на эту тему. Подобные дискуссии противостояли демагогическим рассуждениям критиков и стремлениям устраивать шумиху
в средствах массовой информации вокруг этих
вопросов вместо внимательного их анализа. Но все
встало на свои места. Свидетельством тому служат
научные достижения, описанные в этой книге, и
огромное количество очень полезных и важных
продуктов, полученных в новой, бурно развивающейся биотехнологической промышленности. Может быть, мораторий и введенные вначале ограничения и задержали прогресс, но ненадолго. Возникшее в то время предубеждение против подобных
исследований, по-видимому, можно оправдать неведением, и теперь с уверенностью можно сказать,
что риск был гораздо меньше, чем мы могли предполагать.
Максин Сингер,
Пол Берг
БЛАГОДАРНОСТИ
Вопреки широко распространенному мнению,
наука – это коллективный род деятельности, и многое в ней зависит от хорошо налаженного сотрудничества и общения между учеными. Эта книга –
не исключение. Мы благодарим за сотрудничество
и помощь наших коллег, прочитавших отдельные
разделы и главы книги и высказавших критические
замечания. Это David Finnegan, Claude Klee,
Arthur Kornberg, I.R. Lehman, Howard Nash, Bruce
Paterson, Carl Schmid, Robert Tjian. Мы благодарны
также тем, кто предоставил нам неопубликованные
данные и рукописные материалы.
Пятеро наших коллег прочитали почти всю
книгу в первой редакции. Окончательный ее вариант
был значительно улучшен благодаря их ценным
критическим замечаниям. Мы весьма признательны
за этот труд Barbara H. Bowman, David Dressier,
Paul Schimmel, Jean O. Thomas, William B. Wood.
Нам очень повезло, что мы имели возможность
воспользоваться советами Carol Dempster – одного
из тех редких людей, кто с энтузиазмом и в высшей
степени профессионально вникает во многие научные проблемы. Bruce Armbruster, издатель, президент издательства University Science Books, познакомил нас с Carol Dempster, а также с другими
замечательными членами группы, которые помогали нам выпустить эту книгу: Sylvia Stein Wright,
редактором рукописи; Gary Head, техническим редактором; Mary Miller, менеджером. Но самым
важным было постоянное внимание и неослабевающий энтузиазм самого Bruce Armbruster, которые он проявлял, когда другие дела отвлекали нас
от работы над книгой и она замедлялась и практически останавливалась; мы очень ему за это благодарны.
Молекулярные генетики, говоря о генах и геномах, представляют их зримо. Мы «разглядываем»
ДНК мысленным взором и пытаемся понять, как
она функционирует. Поэтому схемы, приводимые
в научных статьях и книгах, подобных этой, очень
важны для понимания и запоминания материала.
Прекрасные рисунки и диаграммы в этой книге
были сделаны Charlene Kornberg и ее коллегами из
Медицинской школы Сганфордского университета.
Эти иллюстрации являются неотъемлемой частью
текста, поясняя и дополняя его. Наши наивные
представления о процессе создания рисунков и наше
настойчивое желание, чтобы их было как можно
больше, сделали работу над рисунками обременительной и долгой. Мы благодарны всем, кто так
терпеливо работал под руководством Charlene
Kornberg: Meryle Colten, Butch Colyear, Mike May-
stead, Eunice Ockermam, Lois Schoen, Kelly Solis-Navarro, Karen Sullivan, Linda Toda. И только мы, а не
они несем ответственность за некоторые оставшиеся
неисправленными ошибки.
Среди тех неоспоримых преимуществ, которые
получили современные биологи, необходимо отметить прекрасные библиотеки, предусмотрительно
собранные предыдущими поколениями. При написании этой книги мы пользовались тремя такими
библиотеками и работали, огражденные от телефонных звонков и повседневных дел. Все сотрудники библиотеки Лаборатории биологии моря в
Вудс-Холе (шт. Массачусетс), Джексоновской лаборатории в Бар-Харбор (шт. Мэн) и Гопкинсовской океанологической станции в Пасифик-Гроу
(при Станфордском университете, шт. Калифорния)
были неизменно гостеприимны и заботливы.
Harry Woolf, тогдашний директор Института
новейших исследований при Принстонском университете (шт. Нью-Джерси), тоже любезно предоставил нам возможность поработать в таком спокойном месте. Его доброжелательный интерес,
гостеприимство и дружба, а также прекрасное угощение, которым нас потчевал «мастер на все руки»
Franz Moehn, сделали те дни незабываемыми. Как
это ни парадоксально, мы имели возможность работать в Принстоне, не отвлекаясь, также благодаря
тому, что институтские физики и математики почти
не выражали желания беседовать с биологами.
Спокойные дни провел также один из нас (П. Б.),
работая в Клэр-Холл-Колледже Кембриджского
университета. Живое, интеллектуальное общество
во главе с Michael Stoker создавало благоприятный,
способствующий работе климат.
Пока мы писали эту книгу, наука, которая, мы
надеемся, увлечет и вас, шла вперед семимильными
шагами. Непрерывные исправления рукописи ложились тяжелым бременем на людей, ответственно
относящихся к своему делу и обладающих к тому же
чувством юмора, позволявшим им печатать и перепечатывать несчетное множество черновых вариантов. Без Eleanor Olson и Dot Potter (в Станфордском
университете) и May Liu и Gail Gray (в Бетесде)
работа никогда не была бы доведена до конца.
Милли Берг и Дэн Сингер иногда выражали
недовольство и нетерпение (что вполне понятно), но
всегда с готовностью поддерживали нас. С неизменными любознательностью, энтузиазмом, гордостью и любовью относилось к нашей работе
и юное поколение семей Берг и Сингер, хотя ни один
из них не был ни биохимиком, ни молекулярным
биологом.
Часть I
МОЛЕКУЛЯРНЫЕ ОСНОВЫ
НАСЛЕДСТВЕННОСТИ: ОБЗОР
ВВЕДЕНИЕ
Систематическое изучение наследственности
начиналось со сложных в генетическом отношении
объектов – растений и животных. Благодаря этим
ранним исследованиям была сформулирована концепция неделимого гена как функциональной единицы наследственности и принято положение, что
перенос генов от одного поколения к другому подвержен действию разных случайных факторов. Однако до понимания химической природы генов и
механизма их функционирования было еще далеко.
Исследование генетических молекул и тонких механизмов регуляции наследственности стало возможным лишь тогда, когда в качестве экспериментальных моделей начали использоваться бактерии и вирусы, о существовании которых первые
генетики даже не подозревали. Только благодаря
этим организмам впервые было показано, что дезоксирибонуклеиновая кислота (ДНК), рибонуклеиновая кислота (РНК) и белок – универсальные
детерминанты генетического поведения. Стремительность дальнейшего прогресса в этой области
и убедительность полученных результатов стали
реальными
благодаря
особым
биологическим
свойствам микроорганизмов, которые позволяли
проводить манипуляции, необходимые для анализа
генетических структур. Аналогичные аналитические
исследования более сложных генетических систем
тогда были невозможны, поэтому на животных
и растения этот прогресс не распространялся. Развитие технологии рекомбинантных ДНК разрушило
труднопреодолимые технические и концептуальные
барьеры на пути расшифровки и понимания сложных генетических систем. Неудивительно, что наши
взгляды на структуру и функцию генов значительно
изменились, а новое мышление в свою очередь
радикально изменило перспективы биологии.
Некоторые предпосылки последних достижений
можно обнаружить, изучая историю создания фундаментальных положений о наследственности и их
последующих изменений. Основным препятствием
на пути формирования единых принципов наследственности служило исключительное разнообразие
живых форм. Первым, кто проследил аналогии
между процессами воспроизведения животных и
растений и ввел слова «самец» и «самка» применительно к участникам этого процесса, был ученик
Аристотеля – Теофраст. Еще раньше греческие философы V в., воззрения которых оказали заметное
влияние на последующее развитие научных идей,
пришли к заключению, что, поскольку дети похожи
на обоих родителей, оба пола вносят определенный
вклад в формирование нового индивидуума. Они
полагали, что этим вкладом является своего рода
информация, сконцентрированная в мужском или
женском «семени» и поступившая туда из разных
частей тела зрелых индивидуумов. Демокрит, мнение которого не было общепринятым, предположил, что информация заключена в частицах, размер,
форма и строение которых влияют на свойства
потомства.
В начале XIX в., после создания более совершенных микроскопов, основной унифицирующей
единицей в биологии стала клетка. Все организмы
могли рассматриваться как одиночные, свободно
живущие клетки или как сообщество клеток. Постоянное усовершенствование оптических систем
микроскопа и новаторские методы подготовки и
окрашивания материала позволяли все более детально описывать содержимое клеток (рис. I.1).
Эти исследования показали, что клетки окружены
мембраной, имеющей определенную структуру, что
они неодинаковы по форме и что в них имеются
четко различимые структуры, среди которых наиболее удивительной является ядро, содержащее в
свою очередь небольшие, хорошо окрашиваемые
структуры, названные хромосомами. Позднее обнаружили, что некоторые микроорганизмы (бактерии) не имеют ядра. Было установлено, что новые
клетки появляются только в результате деления
предсуществующих клеток.
ЖИВОТНАЯ КЛЕТКА
Центриоли
Плазматическая мембрана
Микротрубочки
Микрофиламенты
Митохондрия
Базальное
тельце
Ресничка
Аппарат Гольджи
Ядрышко
Хроматин
Ядерная
мембрана
Ядро
Рибосома
Эндоплазматический ретикулум
(шероховатый)
Лизосома
Пероксисома
Лейкопласт
Хлоропласт
А
Клеточная стенка
РАСТИТЕЛЬНАЯ КЛЕТКА
13
ВВЕДЕНИЕ
Цитозоль
Рибосомы
ДНК
Цитоплазматическая
мембрана
Клеточная
стенка
Б
РИС. I.1.
А. Схематическое изображение типичных
животных и растительных клеток. Б. Схематическое изображение бактериальной клетки. В. Макрофаги (клетки большего размера) и лимфоциты (клетки меньшего размера), сфотографированные в электронном
микроскопе при увеличении 6000. (С любезного разрешения Emma Shelton, Jan
Ornstein.)
В
В настоящее время все живые организмы подразделяют на две группы. Первая – эукариоты –
многоклеточные организмы, клетки которых содержат оформленное ядро; внутри ядра заключены
хромосомы – хранители генетической информации.
Вторая – прокариоты – представлена одноклеточными бактериями, лишенными ядра, с хромосомами, находящимися в цитоплазме. За немногими
исключениями, все клетки многоклеточного орга-
низма содержат одинаковый полный набор хромосом. Эукариотические организмы имеют более
сложное строение и, как правило, содержат больше
генетической информации. Кроме того, эукариоты
способны к истинному половому воспроизведению
и для многих из них этот способ обязателен для
образования потомства. Одним из важных моментов процесса полового размножения является наличие в дочерних ядрах двух копий каждой хро-
14
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
мосомы; такие эукариотические клетки называются
диплоидными. Прокариоты, содержащие только
одну хромосому, называются гаплоидами. При
некоторых обстоятельствах у прокариот наблюдаются процессы, аналогичные по результату процессу оплодотворения у эукариот, вследствие которых они могут стать частично диплоидными; эти
процессы широко используются в генетических исследованиях.
Сразу после принятия клеточной теории в изучении живых организмов выделились три направления: исследование хромосом, статистический анализ наследования одиночных признаков, выделение
и характеристика компонентов хромосом. Эти на-
Цитокинез
Веретено Звезда
Интерфаза
Центромера
Хромосома
Ядерная мембрана
Телофаза
Ранняя профаза
Анафаза
А
РИС. I.2.
Профаза
Метафаза
Митоз: этапы деления диплоидной клетки. А. На схеме
показаны две пары гомологичных хромосом (они выделены разным цветом). Каждый член пары проходит
через митоз как независимая единица. Во время интерфазы хромосомы имеют вид тонких, диффузных нитей,
которые в норме трудно визуализировать. В это время
происходит дупликация хромосом. Реплицированные
хромосомы конденсируются в дискретные структуры,
которые в стадии профазы легкоразличимы. В проме-
Прометафаза
тафазе хромосомы еще более конденсируются, ядерная
оболочка разрушается и хромосомы оказываются связанными с веретеном. Дуплицированные структуры остаются соединенными друг с другом в районе, называемом центромерой (на рисунке она отмечена точкой).
Обе копии каждой хромосомы – сестринские хроматиды – разделяются по всей длине, за исключением центромеры. К метафазе пары сестринских хроматид выстраиваются у центра веретена, но их центромеры еще
ВВЕДЕНИЕ
Две новые клетки
15
Интерфаза
Анафаза
Профаза
Б
остаются соединенными. В анафазе пары сестринских
хроматид разделяются и каждый член пары движется
по направлению к полюсу веретена. В это же время
и нити веретена, и клетка начинают растягиваться. Когда
в телофазе хроматиды достигают противоположных
полюсов, вокруг каждого набора хроматид формируется новая ядерная оболочка и начинается деконденсация
хромосом. Наконец, плазматическая мембрана разде-
ляет два ядра и окружающую цитоплазму на две клетки
(цитокинез). Хромосомы приобретают растянутую,
диффузную форму, типичную для интерфазы, и процесс деления начинается снова. Б. Микрофотографии
митоза в клетках лилии Haemanthus katherinae. Клетки
окрашены иммунозолотом/серебром. Увеличение 600.
(С любезного разрешения A.S. Bajer.)
16
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
правления параллельно развивались и превращались в важные научные дисциплины до момента их
слияния в середине нашего века.
Митоз
ХРОМОСОМЫ
Во второй половине XIX в. продолжалось детальное изучение морфологии и поведения хромосом. Оказалось, что во всех клетках любого организма, за одним лишь существенным исключением,
содержится одно и то же, вполне определенное
число хромосом. Например, плодовая мушка Drosophila melanogaster имеет 8 хромосом, человек и
летучая мышь – 46, пшеница – 20, носорог – 84. Хромосомы на основе сходства их морфологии могут
быть разделены на гомологичные пары: 4 пары
у D. melanogaster, 23 – у человека и т.д. Микроскопическое исследование фиксированных и окрашенных клеток дает лишь статическую картинку, но эти
картинки можно расположить во временной последовательности, начиная с момента образования
клетки при делении и кончая ее делением на две себе
подобные. И тогда становится очевидным, что
дупликация каждой хромосомы, происходящая в
цикле клеточного деления, приводит к удвоению
числа хромосом (рис. I.2). При делении этот удвоенный набор распределяется таким образом, что
каждая из двух дочерних клеток получает такое же
число и тип хромосом, что и родительская клетка.
Весь процесс в целом называется митозом.
Клеточный цикл
События, происходящие в период от одного
клеточного деления до другого, называются клеточным циклом (рис. I.3). Фаза митоза (М-фаза)
цикла охватывает период деления и хромосом, и
клеток. После расхождения клеток (цитокинеза)
каждая дочерняя клетка вступает в период повышенной биосинтетической активности – в так называемую G1-фазу (от англ. gap). G 1 -фаза заканчивается перед началом удвоения хромосом, или, в
молекулярных терминах, с началом дупликации
хромосомной ДНК; период репликации генома
называется фазой синтеза (S-фазой). С момента
завершения S-фазы в клетках инициируются события, характерные для митотической профазы,– части
цикла, называемой G2-фазой. В конце концов опять
начинаются митоз и цитокинез, и цикл повторяется.
Как правило, G1-, S- и G2-периоды, вместе составляющие интерфазу, занимают около 90% времени
клеточного цикла, а М-фаза – менее 10%. Полное
время прохождения клеточного цикла в клетках
разного типа сильно варьирует (от минут до суток)
в зависимости от условий роста. Основным показателем продолжительности всего цикла является
продолжительность G1-фазы. Например, покоя-
Деление
клетки
Интерфаза
Репликация
ДНК
РИС. I.3.
Клеточный цикл: митоз и цитокинез (клеточное деление) составляют М-фазу цикла, кульминацией которой
является образование двух дочерних клеток. Каждая
дочерняя клетка вступает в G1-период интерфазы и может начать новый клеточный цикл. За периодом G1
следует S-фаза, во время которой ДНК и хромосомы
дуплицируются, и далее – фаза G 2 . Начало митоза означает конец интерфазы. Покоящиеся клетки задерживаются в фазе G1 и, как говорят, находятся в фазе G0.
Обычно эукариотические клетки, которые не остановились в фазе G0, завершают цикл за 24 ч.
щиеся клетки, которые лишены незаменимых питательных веществ и не могут расти экспоненциально,
задерживаются в G1-фазе; говорят, что они находятся в фазе G 0 . При появлении питательных веществ они выходят из G0-фазы и в них возобновляются процессы, характерные для конца фазы G1
с переходом в S-фазу.
РИС. I.4.
Мейоз: этапы деления диплоидной клетки на четыре
гаплоидные дочерние клетки. Этот процесс отличается
от митоза тем, что включает два клеточных деления
и только один «раунд» репликации хромосом. На схеме
показаны две пары гомологичных хромосом (они выделены разным цветом). Во время интерфазы хромосомы
имеют вид тонких диффузных нитей. После репликации
сестринские хроматиды остаются тесно связанными и
начинают конденсироваться, что указывает на начало
профазы. Затем гомологичные пары сестринских хроматид приходят в тесное соприкосновение, образуя
тетрады; этот процесс называется синапсисом. Начало
мейотической метафазы I характеризуется дальнейшей
конденсацией хромосом и дезинтеграцией ядерной
мембраны. В анафазе I члены гомологичной пары сестринских хроматид начинают перемещаться к разным
полюсам удлиняющейся клетки. К концу телофазы I и
клеточного деления I образуются две дочерние клетки,
Ранняя профаза I
Профаза I
Анафаза II
Телофаза II
Прометафаза I
Метафаза II
Предшественники половых клеток
Профаза II
Метафаза I
Телофаза I
в каждой из которых имеется по одной гомологичной
паре сестринских хроматид. Второй раунд клеточного
деления происходит без дополнительной дупликации
хромосом и начинается с профазы II, с переходом
в метафазу II. В стадии анафазы II две сестринские
хроматиды, которые оставались до этого момента вмес-
Анафаза I
те, начинают перемещаться к противоположным концам
удлиняющейся клетки. После телофазы II и клеточного
деления II образуются четыре гаплоидные клетки –
предшественники половых клеток. В каждую дочернюю
клетку попадает только по одной хромосоме из исходных гомологичных пар.
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
18
Мейоз и образование гамет
Образование яйцеклеток и сперматозоидов подразумевает уменьшение нормального числа хромосом ровно вполовину; этот процесс называется
мейозом (рис. I.4). Гаметы, или половые клетки,
гаплоидны, т.е. в них содержится по одному члену
каждой пары гомологичных хромосом, и, таким
образом, только половинное число хромосом каждого из родителей попадает во все другие, соматические, клетки организма потомка. Распределение
хромосом в мейозе происходит случайно, поэтому
любой из членов гомологичной пары может оказаться во вновь образовавшихся зародышевых
клетках.
При оплодотворении гаплоидные наборы хромосом сперматозоидов и яйцеклеток объединяются
(рис. I.5). Таким образом восстанавливается полный набор гомологичных хромосомных пар, каждый из членов которых произошел из яйцеклетки
и из сперматозоида соответствующих родителей.
Диплоидное состояние оплодотворенной яйцеклетки (зиготы) поддерживается далее во всех
соматических клетках механизмом митотического
деления. Иногда зрелые организмы могут развиться
из неоплодотворенных гаплоидных яйцеклеток или
из оплодотворенных яйцеклеток с неполным набором родительских хромосом. Как уже отмеча-
лось, любой из членов гомологичной пары может
попасть в функциональную гамету. В зрелую яйцеклетку или сперматозоид попадает по одному члену
каждой пары в процессе редукции числа хромосом
в мейозе.
Строение хромосом
Легче всего наблюдать метафазные хромосомы.
Под микроскопом их фотографируют или зарисовывают (рис. I.6). В этой стадии хромосомы наиболее сконденсированны и образуют дискретные
структуры. У многих организмов индивидуальные
хромосомы и их гомологи легкоразличимы по
размеру и форме. Каждая метафазная хромосома
действительно состоит из двух идентичных частей,
называемых сестринскими хроматидами, поскольку
дупликация хромосомной ДНК протекает как раз
перед метафазой, в S-фазе клеточного цикла.
У хромосомы имеется перетяжка, называемая
центромерой. Положение центромеры для каждой
хромосомы строго определено. С центромерой связаны специфические хромосомные функции; это
последняя точка, соединяющая плечи сестринских
хроматид перед полным расхождением при митотическом или II мейотическом делении (рис. I.2
и I.4). Сами плечи имеют вид отдельных образований задолго до расхождения центромер в анафазе.
Самка
Самка
Яйцо
Мейоз
Оплодотворение
Зигота
Сперматозоид
РИС. I.5.
Самец
Образование гаплоидных гамет при мейозе и слияние
двух гамет с образованием диплоидной клетки при
оплодотворении. Обратите внимание на то, что у D.
melanogaster, рассмотренной здесь в качестве примера,
как и у других организмов, включая млекопитающих,
две половые хромосомы у самца (X и Y) не гомологичны друг другу. При мейозе формируются два типа
Самец
сперматозоидов, из которых один несет Х-, а другой –
Y-хромосому. У самок, несущих пару Х-хромосом, в
результате мейоза образуются гаметы одного типа. Пол
потомков зависит от того, какую из хромосом – X или
Y – несут оплодотворяющие сперматозоиды. У некоторых организмов (например, у птиц) негомологичную,
определяющую пол хромосому несет самка.
ВВЕДЕНИЕ
Различие между областью центромеры и плечами хромосом становится очевидным после обработки определенными красителями. После окрашивания центромеры выглядят более плотными
и компактными по сравнению с плечами (рис. I.7).
Такие плотные, интенсивно окрашиваемые хромосомные области называются гетерохроматиновыми. Гетерохроматин центромеры можно наблюдать после окрашивания даже в плохо различимых
интерфазных хромосомах. Другие, негетерохроматиновые области хромосом принято называть
эухроматиновыми. Эухроматиновые области окрашиваются гораздо менее интенсивно, чем гетерохроматиновые.
Концевые участки хромосом называются теломерами. Часто они тоже гетерохроматиновые.
Нередко (но не всегда) в митотических хромосомах
можно наблюдать небольшие перетяжки, называемые районом ядрышкового организатора (ЯОР)
(рис. I.8). В мейотических хромосомах они имеют
вид утолщений. В пределах данного вида районы
ядрышковых организаторов встречаются на одной
или нескольких специфических хромосомах (и их
гомологах), и если они есть, то всегда находятся
в одном и том же месте. В G1-фазе клеточного
цикла некоторые ядрышковые организаторы начинают разрастаться; если их больше, чем один, то
такие разросшиеся области объединяются в одну
РИС. I.6.
Центромера
Теломера
Хроматида
Свойства метафазных хромосом эукариот. А. Схематическое изображение двух копий, или хроматид, дуплицированной хромосомы. Две хроматиды удерживаются вместе центромерой, которая в данном случае
находится примерно в центре хромосомы (метацентрическая хромосома). Б. Электронная микрофотография
субметацентрической хромосомы; увеличение 30000.
(С любезного разрешения G.F. Bahr.) В. Фотография
некоторых хромосом человека, полученная с помощью
сканирующего электронного микроскопа. Четко видно,
что хромосомы скручены. [С любезного разрешения
J.B. Rattner. См. J.В. Rattner, С.С. Lin, Cell, 42, (1985),
p. 291.]
А
Б
19
В
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
20
Продолжение рис.
I.6
Г
Г. Хромосома, представленная на этой фотографии,
содержит меньшее количество гистонов и выглядит, как
спутанный клубок. Вверху справа показана ДНК при
большем увеличении. [Микрофотография получена
U.К. Laemmli; см. работу D.W. Fawcett, The Cell, 2nd ed.
(Philadelphia: W.В. Saunders, 1981), p. 237.]
РИС. I.7.
Фотография метафазной хромосомы человека N 13.
Видны общее строение хромосомы (Std), характер полос в эухроматиновых плечах, выявляемый после специального окрашивания (три разных метода окрашивания G, Q и R), гетерохроматиновая область в центромере, наблюдаемая благодаря применению особой техни-
ки окрашивания (С-окрашивание) и район ядрышкового
организатора (ЯОР), также выявляемый с помощью
специального окрашивания (АgЯОР). Положение центромеры на этой акроцентрической хромосоме отмечено
горизонтальной линией. (С любезного разрешения
Т.A. Donlon.)
ВВЕДЕНИЕ
21
А
РИС. I.8.
Б
Фотографии хромосом, на которых видны районы ядрышковых организаторов (ЯОР). А. Метафазные хромосомы человека, обработанные таким образом, что
ЯОР не окрашиваются (показаны стрелками). Видны не
все ЯОР. (С любезного разрешения T.C. Hsu.) Б.
Мейотические хромосомы человека, на которых ЯОР
имеют вид утолщений после окрашивания серебром.
[С. Mirre, M. Hartung, S. Stahl, Proc. Natl. Acad. Sci. USA,
77 (1980), p. 6019.]
или несколько больших, почти сферических структур – нуклеолей (рис. I.1). Часто в интерфазном ядре
только нуклеоли и можно видеть, но с переходом
в профазу они постепенно исчезают.
Применение специальных красителей и особых
способов окрашивания, разработанных в последние несколько десятилетий, дало возможность выявить достаточно тонкие детали в структуре прометафазных и метафазных хромосом, даже если это
довольно мелкие хромосомы млекопитающих.
Итак, после окрашивания в каждой хромосоме
можно наблюдать уникальное чередование светлых
и темных полос; гомологичные хромосомы имеют
идентичный рисунок (рис. I.7). Этот рисунок достоверно воспроизводится, и каждую хромосому
в наборе можно идентифицировать. На рис. I.9
представлен полный набор прометафазных хромосом в клетке человека. На этом изображении, называемом кариотипом человека, отражены относительный размер и форма хромосом наряду с положением центромеры и характерным видом полос.
В интерфазе хромосомы сильно растягиваются
и, как правило, не видны. Встречаются, однако, и
существенные исключения, которые уже много лет
интенсивно исследуются. Секреторные клетки ли-
чинок некоторых насекомых (например, D. melanogaster) разрастаются до огромных размеров и проходят несколько S-фаз без митоза и клеточного
деления. В результате формируется комплекс из
множества, иногда вплоть до тысячи, хроматид,
которые остаются сцепленными и лежат рядом друг
с другом, образуя толстые нити, называемые политенными хромосомами (рис. I.10). Так же как и
все интерфазные хромосомы, политенные хромосомы растянуты значительно сильнее, чем конденсированные метафазные хромосомы. При окрашивании политенных хромосом специальными красителями выявляется определенный рисунок чередования темных и светлых полос. В отличие от того,
что наблюдается в высококонденсированных метафазных хромосомах, число полос огромно. Например, на четырех политенных хромосомах D. melanogaster можно насчитать почти 5000 темных полос, а в полном наборе из 23 метафазных хромосом
человека видны по крайней мере 2000 полос.
Четко различимые морфологические признаки
индивидуальных прометафазных и политенных
хромосом стабильно воспроизводятся из поколения
в поколение у данного вида. Необычная форма
хромосом или характер полос наряду с атипичным
числом хромосом сигнализируют о повреждении
хромосомного материала (рис. I.11). Наличие таких
измененных хромосом часто связано с наследственными заболеваниями. Например, сегмент одной
хромосомы иногда перемещается на совершенно
неродственную хромосому, и такие перестройки
сразу выявляются по необычному размеру или характеру полос. Подобные транслокации иногда
бывают реципрокными, т.е. две неродственные
хромосомы могут обменяться фрагментами. Дру-
22
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Центромера
РИС. I.9.
Кариотип человека. Горизонтальные линии на
всех фотографиях проходят через центромеры.
Хромосомы пронумерованы в порядке уменьшения их длины. А. Полный набор метафазных
хромосом мужчины, окрашенных способом, который выявляет особенности рисунка сегментации. Представлены оба члена каждой гомологичной пары. (С любезного разрешения Uta Francke.)
Б. Идиограмма хромосом, построенная на основании кариотипа, представленного на рис. А.
[D.G. Harnden, H.P. Klinger, eds., An International
System for Human Cytogenetic Nomenclature (Basel:
S. Karger, AG., 1985), p. 50.]
А
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
X
Y
Центромера
1
Б
23
ВВЕДЕНИЕ
РИС. I.10.
Комбинированная фотография (фотомонтаж), на которой показан полный набор гигантских политенных
хромосом, обнаруженных в клетках слюнных желез D.
melanogaster. Все хромосомы соединены своими центромерами (хромоцентр). Каждая из этих интерфазных хромосом состоит из плотно сплетенных множественных хроматид, которые являются репликами
обоих членов гомологичных пар, лежащих параллельно
друг другу. Полосы выявляются при окрашивании; их
характер и относительная ширина уникальны для каждой хромосомы. Обратите внимание на то, что каждая
полоса проходит через весь пучок. [ G. Lefevre, Jr., as
published in Chapter 2, Figure 3, in M. Ashburner,
E. Novitski, eds., The Genetics and Biology of Drosophila,
volume 1a (London: Academic Press, 1976).]
гим примером изменений, или аберраций, хромосом
служат делеции части нормальной хромосомы,
дупликации некоторых областей и даже инверсии
сегментов. Иногда наблюдаются потери хромосом
или, напротив, появление лишних. Например, заболевание человека, известное как синдром Дауна,
обусловлено присутствием трех копий 21-й хромосомы вместо обычных двух (это состояние называют также трисомией 21-й хромосомы).
Успехи в изучении структуры хромосом определялись выбором подходящих экспериментальных
объектов. Так, огромные политенные хромосомы
D. melanogaster стали излюбленной экспериментальной системой еще на заре развития области биологии, именуемой теперь цитогенетикой; систематическое изучение небольших по размеру хромосом
человека и других млекопитающих могло начаться
лишь с усовершенствованием экспериментальной
техники в начале 50-х годов. Хромосомы прокариот
не видны в световом микроскопе; недоступны для
анализа с помощью светового микроскопа и мелкие,
диффузные хромосомы таких низших эукариот, как
дрожжи и трипаносомы.
НАСЛЕДОВАНИЕ
ОДИНОЧНЫХ ПРИЗНАКОВ
Концепция гена восходит к началу 1860 г. и связана с именем Грегора Менделя, хотя до тех пор,
пока другие ученые не повторили и не углубили его
исследования в начале XX в., самого этого термина
не существовало. Слово ген было введено В. Йогансеном (W. Johannsen) в 1910 г. и относилось к
гипотетической единице информации, регулирующей наследование индивидуальных признаков организма. Предположение о существовании генов
было высказано на основании данных о статистическом распределении простых наследуемых признаков в потомстве известных родителей в течение
нескольких поколений. В этих первых исследованиях
генами оперировали как абстрактными статистическими понятиями, поскольку не было никакой
информации относительно химической природы
изучаемых признаков. Например, форма или цвет
семян или цветков рассматривались как видимый
наглядный наследуемый признак независимо от
химической или метаболической основы этого
8
14
1
Центромера
Центромера
Центромера
Б
Нормальная
А
Нормальная
Дефектная
11
Дефектная
РИС. I.11.
Аберрантные хромосомы, являющиеся причиной некоторых заболеваний
человека. На рисунках А и Б вверху
показаны пары нормальных (слева)
и аберрантных (справа) хромосом,
а внизу – соответствующие идиограммы. На этих идиограммах рисунок
сегментации представлен более детально, чем на рис. I.9. А. Транслокация (стрелка) фрагмента хромосомы
8 на хромосому 14 при лимфоме
Беркитта. Б. Делеция (квадратная
скобка) части хромосомы 11 в клетках опухоли Вилмса у человека. (Рис.
А и Б любезно предоставлены U. Franeke.) В. Три копии 21-й хромосомы
в кариотипе пациентки с синдромом
Дауна. (С любезного разрешения
Т.А. Donlon.)
В
25
ВВЕДЕНИЕ
свойства. Тем не менее логический интеллектуальный фундамент, заложенный Менделем и его последователями, вполне соответствует нашим теперешним представлениям о химической структуре
генов и тому, как эта структурная информация
воплощается в свойства организма.
Независимая сегрегация
и независимое комбинирование
Взгляд Менделя на наследственность у эукариот
определялся двумя главными обнаруженными им
явлениями. Первое – существование независимой
сегрегации. Любой организм содержит пару генов
для любого одиночного наследуемого признака, при
этом каждый из членов пары имеет либо отцовское,
либо материнское происхождение. В каждом поколении члены каждой пары генов расходятся с образованием новых яйцеклеток или сперматозоидов,
и во время оплодотворения формируются новые
пары генов. Теперь члены пары называются аллелями и особенность признака зависит от объединения одинаковых аллелей (про организм, несущий
идентичные аллели, говорят, что он гомозиготен)
или различных (тогда организм гетерозиготен). Так,
аллельные пары, детерминирующие некий признак,
могут быть а1а1, а1а2 или а2а2 у разных индивидуумов. Тогда сперматозоиды или яйцеклетки
должны содержать аллель а1 или а2. И хотя
в каждом отдельном организме имеется не более
двух разных аллелей определенного гена, в популяции данного вида циркулирует много различных
аллелей. Например, могут существовать множественные формы гена а: а1, а2, а3, а4 и т.д., поэтому
отдельные индивидуумы могут содержать такие
пары, как а1а2, а2а2, а3а2, а 1 а 4 , а4а5 и а4а4.
Второе важное наблюдение Менделя касалось
независимого комбинирования различных аллельных пар генов, каждая из которых определяет различные признаки. Например, яйцеклетки или сперматозоиды в организме, содержащем аллельные
пары а1а2 для признака а и blb2 для b, могут иметь
l
l
l 2
2 l
2 2
сочетания аллелей a b , a b , a b или a b . При
образовании гамет сегрегация аллельных пар «а» не
зависит от сегрегации аллельных пар «b»; то же
самое можно сказать и о других аллельных парах.
Связь между генами и хромосомами
В начале XX в. была обнаружена корреляция
между физическим поведением хромосом и положениями менделевской генетики. Каждый член
аллельной пары генов мог быть ассоциирован с
одной из хромосом пары, а независимое распределение аллелей можно было объяснить, если считать, что различные аллельные пары находятся
на разных хромосомах. Томас Гент Морган и его
коллеги доказали, что у D. melanogaster гены ассоциированы с хромосомами. Они выбрали этот организм для генетических исследований, поскольку
короткое время генерации и большое число особей
в потомстве, получаемом от каждого скрещивания,
делает генетический анализ удобным и точным;
кроме того, хромосомы D. melanogaster легкоразличимы в световом микроскопе. В ходе экспериментов было установлено, что наследование аллеля,
приводящего к появлению у потомства белых, а не
обычных красных глаз, всегда сцеплено с наследованием Х-хромосом и никогда – Y-хромосомы.
Были обнаружены и другие аллели, коррелирующие
с разными признаками, также связанные с наследованием Х-хромосом, и аллели, наследуемые совместно, сцепленными группами, но независимо от
Х-хромосомы. Таким образом, стало очевидным,
что число групп совместно наследуемых аллелей
соответствует числу хромосомных пар. В ходе
исследования было установлено, что аллели, ассоциируемые с различными хромосомами, распределяются в потомстве независимо, а группы аллелей,
связанные с определенной хромосомой, остаются
сцепленными и в потомстве.
Рекомбинация
Почти одновременно с выявлением групп
сцепления были обнаружены и неожиданные исключения. Например, такие аллели, как а1 и b1 или а2
и b2, как правило, наследовались сцепленно, но
иногда появлялись новые сочетания, a 1 b 2 и а2b1,
которые наследовались в последующих поколениях.
С помощью цитогенетического анализа было установлено, что при мейозе гомологичные хромосомы обвиваются друг вокруг друга, поэтому Морган предположил, что они могут обмениваться
между собой частями, давая тем самым новые
комбинации сцепленных аллелей (рис. I.12). Этот
процесс получил название кроссинговера или рекомбинации. Совершенно не зная химической природы этого явления, генетики использовали феномен рекомбинации в качестве основного инструмента генетических исследований. Определение
частот рекомбинации между сцепленными парами
аллелей у D. melanogaster позволило сделать три
важных заключения: гены расположены в линейном
порядке, и члены аллельных пар обычно занимают
одинаковое относительное положение на гомологичных хромосомах; рекомбинация происходит
только внутри одной группы сцепления (т.е. между
гомологичными хромосомами); частота, с которой
два разных сцепленных аллеля перекрещиваются
(скажем, связываются узелком), зависит от расстояния между ними на хромосоме (чем дальше они
26
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Центромера
Б
РИС. I.12.
А
Кроссинговер хромосом, происходящий при мейозе. А.
Схематическое представление процесса. А и а, В и
b – пары аллелей. Б. Фотография хромосом кобылки
(Chorthippus parallelus) в диплотенной стадии мейоза
(профаза I). Видны гомологичные пары уже дуплицированных хромосом (см. схему). На некоторых парах
видно несколько точек перекреста (хиазмы). Отдельные
пары уже уплотнились в преддверии метафазы I. (С
любезного разрешения В. John.)
друг от друга, тем выше эта частота). Относительное положение различных генов на хромосоме
D. melanogaster, а в дальнейшем и других организмов было установлено именно исходя из этих принципов. К 1922 г. Морган и его коллеги смогли
картировать несколько сотен генов на четырех хромосомах D. melanogaster (рис. I.13).
Связь между генами и белками
Одно из первых предположений о том, как информация, заключенная в генах, проявляется в
специфических свойствах клетки и целого организма, было высказано еще до того, как изобрели слово
«ген». В первом десятилетии XX в. английский врач
Арчибальд Гаррод заметил, что наследование некоторых метаболических идиосинкразий и других
расстройств у людей происходит в соответствии
с правилами Менделя. Он предположил, что
причиной подобных наследственных расстройств
служит недостаток или отсутствие особых ферментов, необходимых для нормального метаболизма.
Тогда же Гаррод высказал гипотезу, что детерминанты
наследственности контролируют образование ферментов. Таким образом, способность к синтезу особых ферментов или даже их свойства связывались
с генами. Предположение казалось очень заманчивым даже при отсутствии экспериментальных
доказательств, потому что оно связывало имеющиеся в то время генетические данные, полученные
для мух и растений, с биологией человека.
Дальнейшее развитие идеи Гаррода могли получить лишь с появлением новых экспериментальных подходов. В конце 1930-х годов такие подходы
появились благодаря использованию в качестве
экспериментальных объектов микроорганизмов.
Вначале в центре внимания исследователей оказались низшие грибы из родов Aspergillus и Neurospora. Эти организмы хорошо росли в определенных
условиях культивирования и достаточно быстро
размножались. К середине 40-х годов было накоплено и проанализировано достаточно генетических
и биохимических данных для того, чтобы прийти
к выводу, что наличие или отсутствие фермента
27
ВВЕДЕНИЕ
РИС. I.13.
Генетическая карта части Х-хромосомы (политенной) D.
melanogaster. Обратите внимание, что каждому гену
соответствует определенный участок политенной хромосомы. Мутация в гене w (область ЗС) обусловливает
белый цвет глаз у мухи. [С.В. Bridges, Journal of
Heredity, 26 (1935), p. 60.]
наследуемо и зависит от экспрессии одного гена.
Джордж Бидл и Эдвард Татум (George Beadle,
Edward Tatum) обобщили связь между ферментом
и геном в виде постулата один фермент – один ген.
Поскольку ферменты – это белки, а многие белки
состоят из более чем одного типа полипептидных
цепей, постулат в дальнейшем стал формулироваться как «один полипептид – один ген». Проведенные исследования показали, что некоторые гены
кодируют белки, не являющиеся ферментами (в том
числе гормоны и структурные белки), а другие гены
контролируют образование молекул РНК, которые
необходимы для синтеза белков.
Для обоих компонентов этой информационной
цепочки часто используются такие термины, как
генотип и фенотип, относящиеся соответственно к
гену и признаку, который им кодируется. В общем
виде генотип иногда трактуется как вся генетическая
информация отдельной клетки или организма.
Аналогично и термин фенотип применяется более
широко для описания видимых свойств клетки или
организма, будь то особые белки или функции либо
морфологические и даже поведенческие признаки.
Фенотип, как правило, является результатом взаимодействия между генетической информацией и
условиями окружающей среды, в которой она реализуется. Термин геном применяется к совокупности
хромосом (на молекулярном уровне – к ДНК),
свойственных отдельному организму (или любой
клетке внутри организма), в отличие от термина
генотип, который относится к информации, заключенной в этих хромосомах (или ДНК).
К 1950 г. была обнаружена еще более заманчивая и многообещающая экспериментальная система для исследования связей между генами и
функциями клетки. Обычная кишечная бактерия
Escherichia coli (E. coli) имеет примитивные питательные потребности и делится каждые 20–60 мин
(в зависимости от условий культивирования), давая
9
в потомстве огромное число клеток (10 в 1 мл).
У нее было обнаружено множество легко выявляемых генетически контролируемых физиологических признаков. Кроме того, использование мутантов, которые достаточно просто выделить и
охарактеризовать, позволило идентифицировать
гены, кодирующие специфические функции клетки.
Таким образом был открыт путь для более формального генетического анализа и создания генетической карты единственной хромосомы E. coli.
Еще одним преимуществом E. coli оказалось то, что
эта бактерия является хозяном для нескольких вирусов (бактериофагов) (рис. I.14), для которых в
свою очередь характерно значительное генетическое
разнообразие инфекционных свойств.
Бактериофаги, или, для краткости, фаги, оказались еще более удобной системой для генетических
исследований. Два или даже больше фагов могут
обмениваться фрагментами своих гомологичных
геномов, порождая фаговое потомство с новыми
генетическими свойствами (рис. I.15). Фаговые геномы даже способны к обратимой интеграции с
бактериальной хромосомой. При выщеплении из
хромосомы фаг может включить в свой геном часть
бактериального генома и, таким образом, стать
носителем бактериальных генов. Анализ подобного
обмена генетическим материалом показал, что даже
такие примитивные организмы обладают упорядоченным геномом и индивидуальные гены могут
составить генетическую карту.
ГЕНЫ И ДНК
Современная биохимическая генетика ведет свое
начало от открытия ДНК в 1869 г. Фридрихом
Мишером (Friedrich Miescher). Он установил, что
вещество, экстрагируемое из гнойной массы и клеточных ядер, химически отличается от белков как по
содержанию органического фосфора, так и по
28
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Б
А
РИС. I.14.
А. Электронная микрофотография бактериофага Т4,
увеличение 200000. (С любезного разрешения
R.С. Williams.) Б. Электронная микрофотография бак-
А
РИС. I.15.
Альтернативные судьбы фаговых хромосом после инфекции. А. Две фаговые хромосомы, несущие различные пары аллелей генов h и r (hr+ или h+r), инфицируют
одну бактериальную клетку. В фаговом потомстве после рекомбинации можно получить четыре разных типа
хромосом: две родительские, hr+ и h+r (без рекомбинации), и две рекомбинантные, hr и h+r+. Б. Фаги с разным
типом хромосом образуют разные бляшки. Бляшки
имеют вид относительно прозрачных пятен на бактериальном газоне. Каждая бляшка начинает образовываться в тот момент, когда из одиночной инфицированной клетки высвобождаются фаговые частицы, которые
териофага λ, увеличение 77000. (С любезного разрешения A.D. Kaiser.)
Б
затем заражают окружающие бактерии и лизируют их.
[Из G.S. Stent, Molecular Biology of Bacterial Viruses (San
Francisco: W.H. Freeman, 1963), p. 335.] В. Рекомбинация между фаговой и бактериальной ДНК. В каждой из
ДНК происходит одиночный разрыв, а затем разорванные концы соединяются так, что фаговая ДНК встраивается в бактериальную. Процесс может быть обратимым:
фаговая ДНК может выщепляться из бактериальной,
причем если это выщепление происходит неточно, то
фаговая ДНК приобретает один или несколько бактериальных генов, а какие-то фаговые гены остаются
в бактериальной хромосоме.
ВВЕДЕНИЕ
устойчивости к расщеплению протеолитическими
ферментами. В течение последующих 85 лет были
разработаны разные методы выделения ДНК с
целью исследования природы ее химических составляющих и связи между ними. Кульминацией этих
исследований стало установление основной структурной единицы ДНК: она состоит из фосфори-
лированного сахара, дезоксирибозофосфата, соединенного с азотистым основанием – либо с одним
из пуринов (аденином или гуанином), либо с одним из
пиримидинов (цитозином или тимином) (рис. I.16).
Кроме того, с помощью биофизических методов
было становлено, что молекула ДНК – это очень
длинная цепочка, остов которой построен из де-
Фаг λ
Е. coli
bio
bio
В
29
30
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Аденин
Тимин
Гуанин
Цитозин
Дезоксирибозилфосфат
Дезоксирибонуклеотиды
РИС. I.16.
Основные структурные элементы ДНК – дезоксирибонуклеотиды.
зоксирибозофосфатных единиц, соединенных друг
с другом фосфодиэфирными мостиками; к каждой
дезоксирибозной единице цепи присоединено либо
пуриновое, либо пиримидиновое основание (рис. I.17).
В 1953 г. Джеймс Уотсон и Фрэнсис Крик обобщили
накопленные к тому времени данные о составе
и структуре ДНК, построив ставшую теперь классической теорию двойной спирали ДНК. Импульсом к ее созданию послужило обогатившее науку
открытие Освальда Эвери (Oswald Avery) и его
коллег, а также Альфреда Херши (Alfred Hershey)
и Маргарет Чейз (Margaret Chase), состоявшее в
том, что только ДНК является носителем генетической информации. Центральная роль в наследственности, приписываемая хромосомам, могла
быть теперь отнесена к ДНК, которую они содержат.
ДНК – не единственная нуклеиновая кислота
(или полинуклеотид), обнаруживаемая в клетке.
Близкородственные
молекулы – рибонуклеиновые
кислоты (РНК) – отличаются от ДНК в основном
тем, что вместо дезоксирибозы содержат рибозу
и чаще имеют одноцепочечную структуру.
Расшифровка структуры ДНК и установление ее
центральной роли в наследственности увенчали
накопленные наукой данные и позволили генетике
из статистической и феноменологической науки
превратиться в науку с преобладанием химических
и молекулярных направлений развития. Незамедлительная бурная реакция ученых на открытие
двойной спирали свидетельствовала об ее адекватности. Модель структуры ДНК не только соответствовала химическим и физическим данным, но
и полностью отвечала функциям, присущим генетическому материалу. В линейной последовательности четырех пуринов и пиримидинов могло быть
закодировано огромное количество информации,
и в принципе эта структура могла обеспечить свою
собственную репликацию. Расшифровка структуры
ДНК проливала свет на самые разные аспекты
биологии и создавала основу для объяснения
многих разноречивых данных, полученных ранее.
Она обеспечила фундаментальную целостность при
интерпретации огромного многообразия жизненных
форм. Раз и навсегда наследственность связывалась
с определенной молекулярной структурой.
ГЕНЕТИКА – МОЛЕКУЛЯРНАЯ НАУКА
Проблемы механизмов переноса, перераспределения и экспрессии генетических признаков, долгое время не находившие решения, с начала 50-х
годов перешли на молекулярный и химический
уровни. Как реплицируются и рекомбинируют
молекулы ДНК? Каким образом они сохраняются
в последующих поколениях? Каким способом информация, закодированная в ДНК, обеспечивает
образование фенотипических продуктов – белков?
Как регулируется считывание информации, закодированной в ДНК, в процессе роста клеток или
развития организма и при других физиологических
состояниях? Как нарушаются эти процессы при
заболеваниях? Эти и еще многие другие вопросы
стояли в центре молекулярно-генетических исследований в течение последних 35 лет. Бурный прогресс в первые 20 из них был достигнут благодаря
использованию систем прокариот и связан с идентификацией молекулярных структур, участвующих
в процессах хранения, поддержания, передачи и
использования генетической информации.
31
ВВЕДЕНИЕ
Пиримидин
Пурин
Б
РИС. I.17.
А. Цепи ДНК состоят из дезоксирибонуклеотидов, соединенных друг с другом фосфодиэфирными связями.
Б. Две такие цепи, закрученные вокруг общей оси,
образуют двойную спираль.
А
Перенос генетической информации
в клетке
Информационные
взаимоотношения
между
ДНК, РНК и белками теперь точно установлены
(рис. I.18). Репликация, с помощью которой создаются идентичные копии родительской молекулы
ДНК, обеспечивает генетическую непрерывность
в ряду поколений. Транскрипция ДНК с образоваием
РНК опосредует трансляцию (перевод) этой информации на уровень белков. Итак, ДНК выполняет две
основополагающие функции. Первая – это осу-
ществление своей собственной репликации. Вторая – это формирование фенотипа через образование
молекул РНК, участвующих в трансляции информации, содержащейся в ДНК, на язык белков. И,
насколько это известно, только у эукариот информация может передаваться в обратном направлении, от РНК к ДНК, посредством процесса, именуемого обратной транскрипцией.
В основе переноса информации от ДНК к РНК
или от РНК к ДНК лежит универсальная способность нуклеиновых кислот служить матрицей.
Нуклеиновые кислоты направляют сборку идентич-
32
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Трансляция
Белок
РИС. I.18.
Информационная связь между ДНК, РНК и белком
и процессы, с помощью которых осуществляется передача информации. Заметим, что обратная транскрипция
наблюдается только у эукариот.
ных или родственных молекул и непосредственно
участвуют в процессе синтеза белка. Насколько
известно, информация не передается от белков к
нуклеиновым кислотам (т.е. обратной трансляции
не обнаружено). Однако белки помимо самосборки
осуществляют важнейшую функцию катализа и
информационного переноса между нуклеиновыми
кислотами.
Далее мы рассмотрим вкратце ключевые характеристики генетического аппарата и его функционирования: структурные особенности важнейших компонентов молекул – ДНК, РНК и белков –
и то, как они работают, обеспечивая сохранение
целостности генома и трансляцию генотипа организма в его фенотип. Эти вопросы детально рассматриваются в гл. 1, 2 и 3, составляющих первую
часть книги.
Структура и сохранение геномной ДНК
Все клеточные ДНК состоят из двух полинуклеотидных цепей, закрученных вокруг общей оси
с образованием двойной спирали (рис. I.19). Наружную поверхность спирали составляет остов
каждой цепи, состоящий из повторяющихся остатков дезоксирибозы. Цепи удерживаются вместе
благодаря водородным связям между пуриновыми
основаниями одной цепи и пиримидиновыми –
другой: аденин всегда спарен с тимином, а гуанин – с
цитозином. В результате образования таких практически инвариантных пар последовательность оснований одной цепи однозначно определяет их
последовательность в другой – иными словами, цепи
двойной спирали ДНК комплементарны.
Молекулы ДНК выполняют две разные функции.
Первая – последовательность пуриновых и пиримидиновых оснований каждой цепи служит матрицей, с которой копируется новая цепь. Вторая –
гены, составляющие ДНК, детерминируют синтез
ферментов и других белков, необходимых для
синтеза новых молекул ДНК. При репликации в особом участке двойной спирали ДНК происходит
расплетание цепей. В результате каждая цепь начинает функционировать как матрица, на которой синтезируется новая, комплементарная цепь (рис. I.19).
Таким образом, каждая из обеих образовавшихся
дочерних спиралей получает одну цепь от родительской спирали, а другую – образованную в
результате синтеза de novo. Несмотря на кажущуюся логическую простоту, процесс репликации
в действительности очень сложен и для его осуществления необходимо множество белков. Важнейшими из них являются ферменты, называемые
ДНК-полимеразами. Их роль в репликации состоит
в сборке полинуклеотидных цепей из отдельных
Дочерняя цепь
Реплика
Родительская цепь
Родительская спираль
РИС. I.19.
Дезоксирибозофосфатный остов
Схематическое изображение реплицирующейся молекулы ДНК. Нижняя часть молекулы еще имеет форму
двойной спирали со спаренными основаниями. В верхней части двойная спираль уже расплетена, и на каждой
родительской цепи синтезируется новая цепь.
33
ВВЕДЕНИЕ
мононуклеотидов (дезоксинуклеотидтрифосфатов).
Все ДНК-полимеразы удлиняют полинуклеотидную
цепь последовательным добавлением отдельных
дезоксинуклеотидов.
Выбор нуклеотида, который должен быть присоединен к цепи, определяется способностью входящего в его состав основания образовывать
комплементарную пару со следующим свободным
основанием цепи-матрицы. Высокая надежность
процесса репликации гарантирует практически безошибочную передачу генетической информации
в ряду поколений.
Одно из открытий, сделанных при изучении
простейших геномов, состояло в том, что они кодируют аппарат для собственного увековечения и
сохранения (т.е. репликации и репарации геномной
ДНК). Более того, генетическая программа допускает возможность перестроек ДНК, и хотя при этом
часто образуются невыгодные, неблагоприятные
перестройки, создаваемые новые комбинации генов
являются материалом для эволюционного экспериментирования. Все геномы содержат информацию, необходимую для синтеза РНК, ферментов
и различных белков, участвующих в этих процессах.
Один из таких процессов – генетическая рекомбинация, в результате которой происходит обмен
между сегментами гомологичных хромосом. Ранее
мы отмечали, что генетические обмены связаны,
по-видимому, со спариванием хромосом в мейозе;
более того, процесс кроссинговера можно визуализировать. Если рассматривать эти события на
молекуляном уровне, то рекомбинация происходит
в местах перекреста и состоит в разрыве и воссоединении цепей в пределах соответствующих (го-
РИС. I.20.
Рекомбинация между двумя гомологичными участками
родительских хромосом, несущими разные аллели генов X, Y и Z. Показаны различные возможные продукты
рекомбинации.
мологичных) областей ДНК рекомбинирующих
хромосом (рис. I.20). Рекомбинация, также генетически детерминированная, может происходить и
между определенными участками ДНК негомологичных хромосом; в результате создаются новые
связи между генетическими структурами. Для осуществления различных процессов рекомбинации,
обнаруженных у прокариот, требуется целая армия
ферментов, обеспечивающих спаривание гомологов
или особых последовательностей и катализирующих разрывы и воссоединение цепей.
Существуют также и специальные механизмы
репарации повреждений ДНК. Облучение клеток
ультрафиолетовым светом или рентгеновскими
лучами либо обработка различными химическими
агентами приводят к повреждениям, затрагивающим основания или остов молекулы ДНК. В ДНК
закодирована информация о синтезе репарирующих
ферментов и белков, поддерживающих целостность
генома любого организма.
Экспрессия и регуляция генов
Белки – основные детерминанты фенотипа организма. Из них построены и ферментативный аппарат, обеспечивающий метаболическую, энергетическую и биосинтетическую активность всех клеток, и регуляторные элементы, координирующие
эти виды активности в ответ на эндогенные и экзогенные сигналы. Белки являются также основными
компонентами многих структурных элементов, характеризующих морфологию клетки и опосредующих ее движение. Говоря в двух словах, организмы – это в конечном счете те белки, которые они
сами и производят.
Постулат «один ген – один полипептид» создал
концептуальную базу для анализа связи генотипа
организма с его фенотипом. Но до решения проблемы структурной организации белков и ДНК, т.е.
до начала 50-х годов, эта теория не имела молекулярной основы. С разработкой новых методов
анализа белковой структуры было установлено, что
каждый белок обладает уникальной линейной аминокислотной последовательностью (рис. I.21, А).
Эта последовательность, называемая первичной
структурой, определяет характер укладки полипептидной цепи с образованием биологически активной
трехмерной формы (рис. I.21, Б и В). Таким образом, структура белка определяется его аминокислотной последовательностью, которая в свою
очередь кодируется генами. Доказательством этому
служит тот факт, что мутации в гене приводят
к изменению аминокислотной последовательности
соответствующего белка. Более того, последовательности мутантных сайтов в генах и последовательности измененных аминокислот в соответст-
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
34
РИС. I.21.
А. Первичная структура белка-ингибитора панкреатического трипсина – из клеток быка. Б. Трехмерная
структура белка (ленточная диаграмма). Видны локальные области вторичной структуры (например, спиральные участки с 47-го остатка по 56-й), а также изгибы
цепи с образованием третичной структуры, стабилизируемой взаимодействиями между аминокислотами, которые не являются ближайшими соседями вдоль полипептидной цепи. Эти взаимодействия осуществляются
между остатками цистеина (цветные шарики) с помощью дисульфидных связей. В. Молекулярная модель
белка. Ленточная диаграмма на рис. Б представляет
собой вид на эту модель снизу. [С любезного разрешения Т.Е. Creighton, J. Mol. Biol., 95 (1975), p. 167.]
А
Б
В
вующих белках коллинеарны, т.е. порядок их следования одинаков. Таким образом, было показано,
что линейное расположение нуклеотидов в ДНК
и аминокислот в белках взаимосвязано, т.е. одна из
характеристик генетического кода установлена.
Идея генетического кода подразумевает существование определенного механизма перевода нуклеотидной последовательности ДНК в аминокислотную последовательность белков. С середины 50-х до
начала 60-х годов молекулярные основы генетического кода и механизм его расшифровки при
сборке полипептидной цепи были установлены.
Раскрытие этой тайны стало одним из монументальных достижений молекулярной генетики. Неожиданно код оказался очень простым и абсолютно
одинаковым для всех жизненных форм. Более того,
выяснилось, что универсальны и общие правила
трансляции генетически закодированных посланий.
35
ВВЕДЕНИЕ
GCA
GCG
GCT
GCC
Ala
AGA
AGG
CGA
GGA
ATA
CGG
GGG
CGT GAT AAT TGT GAA CAA GGT CAT ATT
CGC GAC AAC TGC GAG CAG GGC CAC АТС
Arg Asp Asn Cys Glu
Gln
Gly
His
TTA
TTG
СТА
CCA
CTG
CCG
CTT AAA
TTT CCT
CTC AAG ATG TTC CCC
Ileu Leu
Lys
Met Phe
Pro
AGT
AGC
TCA
TCG,
TCT
TCC
Ser
АСА
GTA
GTG TAA
ACG
ACT
TAT GTT TAG
ACC TGG TAC GTC TGA
Thr
Trp
Tyr
Val stop
РИС. I.22.
Генетический код.
Генетический словарь состоит из 64 кодонов,
каждый из которых представлен тремя последовательно расположенными нуклеотидами в цепи ДНК
(рис. I.22). 61 из 64 триплетов кодируют аминокислоты, причем каждый триплет – только одну
аминокислоту. Один из этих триплетов имеет двойную функцию: кодирует аминокислоту метионин
и обозначает начало фрагмента ДНК, кодирующего
белок. Каждый из трех остальных триплетов может
служить сигналом окончания последовательности,
кодирующей белок. Генетический код вырожден,
поскольку одной и той же аминокислоте может
соответствовать более чем один кодон; но, с другой
стороны, код не двусмысленный, потому что любой
кодон обозначает только одну аминокислоту. Если
известен словарь кодонов, то перевести генную
последовательность в соответствующий белковый
продукт не составляет труда.
Нематричная цепь
Инициация
транскрипции:
расплетание ДНК
в начале гена
Синтез РНК путем
комплементарного
спаривания с
матричной цепью ДНК
Перемещение места
синтеза вдоль
молекулы ДНК
Матричная цепь
РНК
Участок ДНК
вновь заплетен
Транскрипция
доходит до
конца гена
Отделение молекулы
РНК и восстановление
спиральной структуры
ДНК
РИС. I.23.
Основные этапы транскрипции. Нуклеотидная последовательность РНК такая же, как у нематричной цепи ДНК.
36
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Рибосома
мРНК
А
Синтезируемая
полипептидная цепь
Б
В
РИС. I.24.
Основные этапы трансляции матричной РНК с образованием белка (полипептидная цепь и мРНК изображены
без соблюдения масштаба). А. Первая рибосома уже
заняла свое место на мРНК; она несет короткий полипептид – начальный участок кодируемого белка. Б. Картина, наблюдаемая через несколько секунд. Рибосома
перемещается по мРНК, которая диктует последовательное присоединение аминокислот к полипептидной
цепи. Такой же процесс осуществляется с участием
второй, третьей и четвертой рибосом, в результате чего
на мРНК образуется полирибосомный кластер. В. Первая рибосома завершила сборку полипептидной цепи.
Полипептидная цепь отделяется от рибосомы, а последняя отделяется от мРНК. Укладка синтезируемых полипептидных цепей и образование вторичной и третичной структуры начинаются еще до завершения их синтеза.
Для экспрессии гена в виде белкового продукта
сначала должна произойти транскрипция ДНК с
образованием РНК (рис. I.23). Этот процесс
осуществляется с помощью РНК-полимераз – ферментов, катализирующих синтез цепи РНК путем
копирования нуклеотидной последовательности
одной цепи ДНК с помощью комплементарного
спаривания оснований. Гены, кодирующие белки,
детерминируют синтез молекулы «мессенджер»,
или матричной РНК (мРНК), называемой так по-
Отделившаяся рибосома
Полностью синтезированная
полипептидная цепь
тому, что она несет генетическую информацию,
закодированную в соответствующем сегменте ДНК,
и непосредственно участвует в сборке белков.
Некоторые гены не кодируют никаких белков. При
их транскрипции образуются не мРНК, а молекулы
РНК, необходимые для образования зрелых РНК
разного типа и для трансляции мРНК в белки.
Исследование взаимодействия РНК-полимераз
и других вспомогательных белков транскрипции
с ДНК расширило наши знания о специфичности
ВВЕДЕНИЕ
и прочности межмолекулярных взаимодействий.
Так, было показано, что осуществляются очень
точные молекулярные контакты между белками и
специфичными группами нуклеотидов в ДНК, а это
в свою очередь открыло новые перспективы в исследовании проблем экспрессии и регуляции генов.
Мы вкратце прокомментируем, как такие взаимодействия опосредуют регуляцию работы генов.
В рамках вводной главы невозможно описать
такой совершенный процесс, как трансляция последовательности нуклеотидов матричной РНК в
белковую цепь. Он действительно очень сложен
и состоит из множества повторяющихся этапов
(рис. I.24). Трансляцию молекул мРНК в белки
катализируют рибонуклеопротеиновые частицы
(рибосомы), содержащие более 50 различных белков
и три вида молекул РНК. Синтез белковой цепи
начинается с присоединения рибосом к матричной
РНК. Белковая цепь удлиняется на одну аминокислоту, когда рибосома продвигается вдоль молекулы
мРНК на один кодон. Ключевой момент трансляции – перевод генетической информации, закодированной в триплетных кодонах матричной РНК,
в специфические аминокислоты – зависит от комплементарного спаривания оснований. Каждая аминокислота присоединяется к особой, родственной ей
транспортной РНК (тРНК), содержащей триплет
(антикодон), комплементарный кодоновому триплету в матричной РНК. Благодаря спариванию оснований между кодоном мРНК и антикодоном тРНК
нужная аминокислота занимает свое место в растущей полипептидной цепи. За один цикл перемещения рибосомы по всей длине молекулы мРНК,
кодирующей данный белок, образуется одна молекула этого белка.
Изучение экспрессии генов – только один из
аспектов исследования механизма их действия.
Другой связан с регуляторными процессами, контролирующими время и степень экспрессии при
разных условиях. Неудивительно, что прогресс в
понимании механизма транскрипции и трансляции
позволил прояснить и проблему регуляции. Так,
было показано, что у бактерий регуляция экспрессии
37
генов происходит дифференцированно. Действительно, при некоторых условиях многие гены не
экспрессируются вовсе, а степень экспрессии других
различается на порядки. Однако изменение условий
может приводить к активации молчавших ранее генов и, напротив, к репрессии активных. Это предоставляет клеткам широкие возможности для изменчивости, обеспечивающей приспособленность их
фенотипов к условиям среды.
Экспрессия генов обычно регулируется на
уровне образования РНК. Как правило, инициация
транскрипции регулируется либо репрессорными
белками, блокирующими транскрипцию, либо
активаторными, необходимыми для ее запуска. В
первом случае экспрессия начинается после снятия
репрессии в результате модификации белка-репрессора. Во втором ген транскрибируется только
в том случае, если активаторный белок находится
в соответствующем функциональном состоянии.
Репрессорные и активаторные белки – не единственные средства регуляции транскрипции. В некоторых случаях белки – продукты генной экспресии –
сами служат регуляторами транскрипции собственных генов. Известны также случаи, когда на
эффективность транскрипции влияют структурные
изменения в ДНК. Образование РНК может регулироваться и путем контроля скорости элонгации
или места ее окончания, т.е. транскрибироваться
может весь ген или какая-то его часть при наличии
специфического стоп-сигнала. Экспрессия генов
может также регулироваться на уровне трансляции
матричной РНК в белки. В этом случае специфическая регуляция тоже обычно осуществляется на
начальных этапах процесса декодирования.
В этом вводном разделе мы кратко описали
зарождение генетики и ее эволюцию, в ходе которой
были созданы молекулярные основы этой науки.
Материал, позволяющий понять эти основы, представлен главным образом в гл. 1–3, составляющих
часть I книги. Данные, которые были получены при
использовании микроорганизмов (бактерий и их
вирусов) в качестве объектов исследования, создали
фундамент для изучения более сложных геномов
эукариот.
Глава 1
МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
Генетическая информация у всех клеток закодирована в виде последовательности нуклеотидов
в дезоксирибонуклеиновой кислоте (ДНК). Первый
этап реализации этой информации состоит в
образовании родственной ДНК молекулы – рибонуклеиновой кислоты (РНК), которая в свою очередь участвует в синтезе специфических белков.
Фенотипические признаки любого организма в конечном счете проявляются в разнообразии и количестве белков, кодируемых ДНК. Информационная
связь между молекулами генетического аппарата –
ДНК, РНК и белками – представлена на рис. 1.1.
Чтобы генетическая информация могла передаваться от одного поколения клеток к другому,
должна происходить репликация ДНК – процесс, в
ходе которого родительские молекулы ДНК удваиваются и затем распределяются между потомками. Этот процесс должен осуществляться с большой точностью, а повреждения или случайные
ошибки, возникшие в ДНК во время циклов репликации или между ними, необходимо исправить
прежде, чем они попадут в геномы потомков.
Кроме того, для формирования фенотипа генетическая информация должна экспрессироваться. У
всех клеточных организмов экспрессия генов включает копирование ДНК с образованием РНК (транскрипцию) и последующую трансляцию РНК в белки.
Как будет показано в гл. 3, при транскрипции
образуется несколько типов РНК. Одни из них,
матричные РНК (мРНК), кодируют белки, другие
участвуют в различных процессах, необходимых для
сборки полноценного белка. ДНК не только кодирует ферментативный аппарат клетки; она участвует в процессах репарации, а при определенных
условиях в ней могут происходить перестройки.
Репликация, репарация и перестройки ДНК – ключевые процессы, с помощью которых организмы
поддерживают свойственный им фенотип и изменяют его.
У многих вирусов генетическая информация
также закодирована в ДНК. Механизмы репликации, репарации, перестройки и экспрессии вирусной
ДНК аналогичны механизмам, используемым клетками других организмов. Геном некоторых вирусов
представлен не ДНК, а РНК. Геномная РНК таких
вирусов либо непосредственно транслируется в
белки, либо обладает генетической информацией,
необходимой для синтеза молекул РНК, которые
в свою очередь транслируются в белки. Те вирусы,
у которых геном представлен РНК в течение всего
жизненного цикла, должны сами реплицировать
родительскую РНК для получения потомства вирусных частиц. Существует класс ретровирусов,
репродуктивный цикл которых начинается с того,
что их генетическая информация в ходе так называемой обратной транскрипции переводится на язык
ДНК. Полученные копии ДНК, или провирусы,
способны к репликации и экспрессии только после
интеграции в хромосомную ДНК клетки. В такой
интегрированной форме вирусные геномы реплицируются вместе с ДНК клетки-хозяина, и для
образования нового поколения вирусных геномов
и мРНК, нужной для синтеза вирусных белков, они
используют транскрипционный аппарат клетки.
Ключевым моментом в передаче генетической
информации между нуклеиновыми кислотами, будь
то репликация, транскрипция или обратная транскрипция, является то, что молекула нуклеиновой
кислоты используется в качестве матрицы в направленной сборке идентичных или родственных
структур. Насколько известно, информация, хранящаяся в белках, не используется для сборки соответствующих нуклеиновых кислот, т.е. обратная
трансляция не обнаружена. Тем не менее белки
играют ключевую роль в процессах передачи информации как между нуклеиновыми кислотами, так
и от нуклеиновых кислот к белкам.
Транскрипция РНК
и репликация
Транскрипция
Трансляция
Репликация
Обратная
транскрипция
РИС. 1.1.
Информационная связь между ДНК, РНК и белками.
39
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
В этой главе мы рассмотрим химические и физические характеристики ДНК, РНК и белков, поскольку секреты генотипических и фенотипических
функций этих молекул скрыты в их молекулярной
структуре и свойствах. Механизмы репликации, репарации и рекомбинации нуклеиновых кислот детально
обсуждаются в гл. 2, а механизмы транскрипции
и трансляции в процессе экспрессии генетической
информации – в гл. 3.
1.1. СТРУКТУРА И ПОВЕДЕНИЕ ДНК
а. Компоненты молекулы ДНК и
соединяющие их химические связи
С помощью химических и физических методов
установлено, что ДНК – это полимер, состоящий из
четырех разных, но родственных мономеров. Каждый мономер – нуклеотид – содержит одно из четырех гетероциклических азотистых оснований: аденин
(А), гуанин (G), цитозин (С) или тимин (Т), связанное с дезоксирибозофосфатом (рис. 1.2). Длин-
ные полинуклеотидные цепи образуются путем
соединения дезоксирибозных остатков соседних
нуклеотидов с помощью фосфодиэфирных связей
(рис. 1.3). Каждый фосфат соединяет гидроксильную группу (ОН) при 3'-углеродном атоме дезоксирибозы одного нуклеотида с ОН-группой при
5'-углеродном атоме дезоксирибозы соседнего нуклеотида.
Частота встречаемости в определенном соседстве любых двух оснований в ДНК бактерий, бактериофагов и дрожжей зависит от количественного
содержания этих оснований в ДНК (табл. 1.1).
Частота встречаемости 5'-CG-3' и 5'-GC-3' в ДНК
прокариот почти одинакова и близка к случайной;
то же самое можно сказать и о динуклеотидах
5'-GA-3' и 5'-AG-3'. Однако в ДНК животных, вирусов животных и растений частоты встречаемости
5'-CG-3' составляют от 1/2 до 1/5 частот 5'-GC-3'.
Таким образом, последовательность 5'-CG-3' встречается в ДНК высших эукариот довольно редко; это
связано со способностью данного динуклеотида
служить мишенью при метилировании и с его
ролью в регуляции экспрессии генов.
После окончания цикла синтеза ДНК некоторые
пуриновые и пиримидиновые основания могут подвергаться химической модификации. В результате
в некоторых ДНК содержатся 5-метилцитозин,
5-гидроксиметилцитозин,
5-гидроксиметилурацил
и N-метиладенин (рис. 1.4). В ДНК некоторых
бактериофагов к гидроксиметильной группе гидроксиметилцитозина присоединены с помощью
РИС. 1.2.
Дезоксирибонуклеотиды. Цифрами обозначены положения атомов в гетероциклических кольцах пуринов
(аденин и гуанин) и пиримидинов (тимин и цитозин)
и углеродных атомов в дезоксирибозе.
Дезоксиаденозинмонофосфат, dAMP
Дезокситимидинмонофосфат, dTMP
Дезоксигуанозинмонофосфат, dGMP
Дезоксицитидинмонофосфат, dCMP
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
40
РИС. 1.3.
5'-конец
Связь между соседними дезоксирибонуклеотидами в
полинуклеотидной цепи. В правом нижнем углу рисунка
показаны некоторые способы схематического изображения дезоксирибонуклеотидной последовательности.
Нуклеотидную последовательность принято изображать
слева направо, от 5'- к 3'-концу.
Аденин
Таблица 1.1. Частоты встречаемости некоторых
ближайщих соседей в различных ДНК
Источник ДНК
Отношение
5'-CG-3'/5'-GC-3' 5'-AG-3'/5'-GA-3'
Вирусы бактерий
λ
Т2
Бактерии
Escherichia coli
Micrococcus lysodeikticus
Bacillus subtilis
Вирусы животных
SV40
Полиомавирусы
Вирус папилломы
Шоупа
Одноклеточные
эукариоты
Saccharomyces cerevisiae
Chlamydomonas
Многоклеточные
эукариоты
Цыпленок
Человек
Мышь
Корова
Пшеница
Цитозин
Гуанин
1,02
0,82
0,90
0,96
0,95
1,15
0,82
1,0
0,75
0,87
0,14
0,35
0,44
1,35
1,28
1,16
0,87
0,68
0,96
1,36
0,21
0,23
0,23
0,36
0,78
1,28
1,15
1,15
1,10
0,97
Тимин
pApCpGpTp
ACGT
З'-конец
гликозидной связи моно- или дисахариды. ДНК
большинства низших эукариот и беспозвоночных
содержат относительно мало 5-метилцитозина и
N6-метиладенина. Однако у позвоночных метилирование оснований – частое явление, причем наиболее распространен 5-метилцитозин. Показано, что
более 95% метильных групп в ДНК позвоночных
содержится в остатках цитозина редко встречающихся CG-динуклеотидов и более 50% таких
динуклеотидов метилировано. Существуют четкие
указания на то (разд. 8.7), что степень метилирования некоторых CG-содержащих последовательностей является важным фактором регуляции
экспрессии определенных генов. У растений 5-ме-
41
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
5-метилцитозин
N6-метиладенин
5'-гидроксиметилурацил
5-гидроксиметилцитозин
Глюкозил-НМС
РИС. 1.4.
Структурные формулы модифицированных пуринов и
пиримидинов, обнаруженных в ДНК.
(НМС)
Гентиобиозил-НМС
мерно перпендикулярны оптической оси спирали.
Спираль делает полный оборот каждые 3,4 нм, т.е.
через каждые 10 оснований. На наружной ее поверхности имеются два желобка – большой и малый.
тилцитозин можно обнаружить в динуклеотидах CG
и тринуклеотидах CNG (N – C, А или Т).
б. Спиральная структура ДНК
С помощью физико-химических, электронномикроскопических и рентгеноструктурных методов показано, что большинство молекул ДНК представляют собой протяженные, гибкие, нитевидные
структуры. Этими же методами установлено, что
молекула ДНК имеет почти постоянный диаметр
и состоит из регулярно расположенных повторяющихся звеньев, причем ее структура не зависит
от нуклеотидного состава. Таким образом, в отличие от белков, двух- и трехмерная структура которых обязательно зависит от состава и порядка
расположения аминокислот (разд. 1.3), молекула
ДНК в обычных условиях при любом нуклеотидном
составе и порядке расположения четырех нуклеотидов представляет собой абсолютно регулярную
практически идентичную по всей длине структуру.
Такие в какой-то степени парадоксальные химические и физические свойства ДНК порождаются
особенностями ее структуры.
Молекула ДНК обычно находится в форме
двойной спирали, образуемой двумя полинуклеотидными цепями, обвивающимися одна вокруг другой. Два дезоксирибозофосфатных остова, расположенные по периферии молекулы, имеют антипараллельную ориентацию (рис. 1.5 и 1.6). В наиболее часто встречающейся структурной форме
пуриновые и пиримидиновые основания в каждой
цепи уложены в стопки с интервалом 0,34 нм и направлены внутрь спирали; плоскости колец при-
Малый
желобок
Большой
желобок
РИС. 1.5.
Схематическое изображение В-формы двойной спирали ДНК. Видны большой и малый желобки. Указаны
расстояние между ближайшими парами оснований и
шаг спирали. [A. Kornberg, DNA Replication (San Francisco: W. H. Freeman, 1980).]
42
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Пары
оснований
Малый
желобок
Большой
желобок
РИС. 1.6.
Пространственная модель В-формы двойной спирали
ДНК. (С любезного разрешения Dr. Melson Max, Lawrence Livermore National Labs.)
Азотистые основания четырех нуклеотидов ДНК
не находятся между собой в количественном соотношении 1:1, как это представлено на рис. 1.3.
Напротив, молярные отношения двух пуринов,
А и G, и двух пиримидинов, Т и G, различны для
ДНК разных организмов (табл. 1.2). В то же время
соотношение между пуринами и пиримидинами
постоянно и не зависит от источника ДНК, а
именно: содержание пуриновых нуклеотидов (A + G)
всегда равно содержанию пиримидиновых нуклеотидов (Т + G); число А равно числу Т, и аналогично
для G и С. Эти факты и легли в основу предположения, что пуриновые и пиримидиновые нуклеотиды в ДНК спарены, а двойная спираль стабилизируется с помощью водородных связей между
пуринами одной цепи ДНК и пиримидинами другой
(рис. 1.5 и 1.6).
Два указанных типа пар оснований, AT и GC,
обычно называемых комплементарными парами,
преобладают в большинстве ДНК (рис. 1.7). В
АТ-паре основания соединены двумя водородными
связями: одна из них образуется между аминои кето-группами, а другая – между двумя атомами
азота пурина и пиримидина соответственно. В
GC-паре имеются три водородные связи: две из них
образуются между амино- и кето-группами соответствующих оснований, а третья – между атомами
азота. Образование пар между двумя пуринами,
двумя пиримидинами или некомплементарными
основаниями (А + С или G + T) стерически затруднено, поскольку при этом не могут образовываться
подходящие водородные связи и, следовательно,
нарушается геометрия спирали. Модифицированные пурины и пиримидины, с небольшой частотой
встречающиеся в ДНК (рис. 1.4), образуют такие же
водородные связи, что и их немодифицированные
аналоги; тем самым правило спаривания не нарушается. Согласно этим правилам, последовательность оснований в одной цепи определяет их последовательность в другой. Комплементарность последовательности оснований в двух полинуклеотидных цепях – ключевое свойство ДНК.
Дополнительная стабилизация двойной спирали обеспечивается межплоскостными взаимодействиями ароматических колец соседних оснований. Размеры комплементарных пар оснований
практически одинаковы; примерно одинаковы также
угол и направление связи дезоксирибоза-основание. Расстояние между соседними основаниями
равно 0,34 нм, а угол, на который они повернуты
друг относительно друга,– 36°. Из всех этих данных
следует, что диаметр спирали постоянен, а число
пар оснований на виток спирали равно 10 (рис. 1.5).
Точные данные о расположении, ориентации в
пространстве и размерах различных составляющих
ДНК были получены методом рентгеноструктурного анализа волокон ДНК.
в. Альтернативные формы двойной
спирали ДНК
Все, о чем мы говорили, касалось наиболее
распространенной, так называемой В-формы двойной спирали ДНК. Известны также два других
изомерных типа двойной спирали. Они образуются
благодаря тому, что валентные углы между основаниями и сахаром могут меняться, а дезоксирибозное кольцо и сахарофосфатный остов достаточно гибки, чтобы могли сформироваться альтернативные конфигурации. Редко встречающаяся
А-форма, существующая только при пониженной
влажности, отличается от В-формы тем, что плоскости оснований составляют с перпендикуляром
43
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
Таблица 1.2. Нуклеотидный состав различных ДНК
А1)
Источник
Бактериофаг λ
Бактериофаг Т2
Escherichia coli
Bacillus subtilis
Вирус папилломы Шоупа
Saccharomyces cerevisiae
Chlamydomonas
Цыпленок
Мышь
Корова
Пшеница
1)
2)
3)
26,0
32,5
23,8
29,0
26,6
31,3
19,6
27,9
28,9
27,3
27,2
G
23,8
18,2
26,0
20,7
24,5
18,7
30,2
21,2
21,1
22,5
22,6
С
24,3
Т
2)
16,7
26,4
21,3
24,2
17,1
3)
30,0
3)
21,5
3)
20,3
3)
22,5
3)
22,8
25,8
32,6
23,8
29,0
24,7
32,9
19,7
29,4
30,0
27,7
27,4
А+Т
A+G
G +C,
G+C
Т+С
мол. %
0,99
48
2)
35
52
42
49
36
3)
60
3)
433)
41
3)
44
3)
45
1,08
1,86
2)
0,91
1,38
1,05
1,79
3)
0,65
3)
1,34
3)
1,44
3)
1,22
3)
1,20
1,03
0,99
0,99
1,04
1,00
2)
3)
0,99
3)
0,96
3)
1,00
3)
0,99
3)
0,99
Использованы общепринятые сокращенные обозначения пуринов и пиридинов.
5-гидроксиметилцитозин.
Включая 5-метилцитозин.
к оси спирали угол 20° (рис. 1.8). Поэтому расстояние между парами оснований по вертикали
уменьшается до 0,29 нм, а число пар на виток
увеличивается до 11–12. Какова биологическая
функция А-формы ДНК – пока неясно.
Характерной особенностью В-формы ДНК
является то, что сахарофосфатные остовы обеих
цепей образуют правую спираль (рис. 1.5 и 1.6).
Однако при определенных условиях участки ДНК,
для которых характерно чередование пуриновых
Тимин (Т)
Аденин (А)
Цитозин (С)
Гуанин (G)
Водородные связи между комплементарными основаниями в ДНК. Видно, что геометрия двух типов пар
оснований практически одинакова. [A. Kornberg, DNA
Replication (San Francisco: W. H. Freeman, 1980.)]
РИС. 1.7.
44
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Большой
желобок
Большой
желобок
Малый
желобок
Малый
желобок
В-ДНК
РИС. 1.8.
Желобок
А-ДНК
Z-ДНК
Пространственные модели В-, А- и Z-ДНК (каждая из
моделей содержит 20 пар оснований). Атомы фосфора
и связанные с ними атомы кислорода изображены
в виде темных шариков, атомы азота – в виде слегка
затененных шариков. Сплошная линия, соединяющая
фосфатные группы, показывает ход полинуклеотидной
спирали. Обратите внимание на зигзагообразную фор-
му остова Z-ДНК. А-ДНК короче и толще, а Z-ДНК чуть
длиннее и тоньше, чем В-ДНК. В А-ДНК большой
желобок более глубокий, но зато малый уплощен и
напоминает обвитую по поверхности ленту. У Z-ДНК
желобок только один, он чуть глубже, чем большой
желобок у В-ДНК, но не такой глубокий, как у А-ДНК.
(С любезного разрешения A. Rich.)
и пиримидиновых нуклеотидов, принимают форму
левой спирали. При этом расстояние между соседними парами оснований увеличивается до 0,77 нм,
а число пар на один виток – до 12. Остов молекулы
ДНК имеет зигзагообразный вид, поэтому подобная форма получила название Z-ДНК. Вопрос о
том, существует ли Z-ДНК в естественных условиях
и образуется ли она в определенных участках
В-спирали под действием специфических белков,
способных переводить В-форму в Z-форму, сейчас
интенсивно исследуется (гл. 8, разд. 8.7).
длиной молекулы ДНК и массой одной небольшой
хромосомы (табл. 1.3). Так, молекулы ДНК единственных хромосом, из которых состоят геномы бактериофагов λ и Т4, а также адено- и герпесвирусов,
имеют длину, соответствующую числу пар оснований в одной хромосоме, составляющей геном
каждого из этих вирусов. Полный геном E.coli
(~ 4•106 п.н.) также представлен единственной
молекулой ДНК и имеет длину 1,4 мм. Есть все
основания считать, что каждая из хромосом дрожжей, Drosophila и даже человека состоит из одной
молекулы ДНК размером от нескольких десятков
тысяч до многих миллионов пар нуклеотидов.
г. Размер молекул ДНК
Обычно размер молекулы ДНК выражается в
числе пар нуклеотидов, при этом за единицу берется
тысяча пар нуклеотидов (т.п.н.). Мол. масса одной
т.п.н. В-ДНК равна в среднем 6,6•105, а ее длина
составляет 340 нм. Если принять все необходимые
меры, чтобы не разрушить ДНК при выделении,
и использовать мягкие методы измерения длины, то
обнаружится удивительное соответствие между
д. Разнообразие форм ДНК
Существовавшее до недавнего времени мнение
о том, что В-ДНК – это совершенная двойная спираль, геометрия которой одинакова независимо от
нуклеотидной последовательности, в действительности не совсем корректно. Детальный рентгеноструктурный анализ, построение моделей и термодинамические расчеты показали, что плоскости со-
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
45
Таблица 1.3. Молекулярная масса, длина и тип структуры ДНК различного происхождения
Источник
Мол. масса
Длина
Число пар
оснований
Тип структуры
Бактериофаг φХ174
SV40
Бактериофаг Т2
Хромосома Hemophilus influenzas
Хромосома Escherichia coli
Saccharomyces cerevisiae
Хромосома 1
Хромосома 12
Drosophila melanogaster
Хромосома 2
Хромосома 3
Хромосома 4
1,6•106
3,5•106
1,2•108
7,9•108
2,6•109
1,6 мкм
1,1 мкм
50 мкм
300 мкм
1 мм
5•1031)
5,2•103
2•105
1,2•106
4•106
Кольцевая одноцепочечная
Кольцевая двухцепочечная
Линейная двухцепочечная
Неизвестен
Кольцевая двухцепочечная
1,4•108
1,5•109
50 мкм
500 мкм
2,1•105
2,2•106
Линейная двухцепочечная
1)
10
4•10
4,2•1010
4•109
15 мм
16 мм
1,5 мм
7
6,0•10
6,3•107
6•106
То же
»
»
»
»
»
»
В данном случае указано число оснований, а не пар оснований.
седних пар оснований не строго параллельны. Каждая комплементарная пара оснований является как
бы клином, отклоняющим ось спирали в одном или
в другом направлении. Наибольший «крен» наблюдается тогда, когда два соседних аденина в одной
цепи спарены с двумя тиминами другой. В этом
месте происходит локальное искривление спирали.
Если такие пары встречаются с периодичностью
примерно один раз на 10 пар (т.е. один раз на
каждый виток спирали), то молекула ДНК приобретает заметно искривленную форму. Искривленная, или изогнутая, структура была, например,
обнаружена в линейных фрагментах ДНК кинетопластов трипаносомы Leishmania tarentolae по
аномально малой подвижности этих фрагментов при
электрофорезе в полиакриламидном геле. Изгибы
в молекуле ДНК наблюдаются в тех участках
последовательности, где с необычно высокой частотой встречаются повторы (А•Т) 5–6 , разделенные GC-богатыми участками из четырех-шести
нуклеотидов. Биологическая роль искривления ДНК
окончательно не установлена. Предрасположенность к такому изгибанию, зависящая от последовательности оснований, может иметь значение при
наматывании молекулы ДНК на гистоновые октамеры в хроматине (разд. 1.1.ж). Возможно, изгибание ДНК существенно и при специфическом связывании ДНК с белками в процессе регуляции
экспрессии генов.
ДНК может находиться в линейной или кольцевой форме (рис. 1.9). Бактериальные плазмиды,
хромосомы некоторых бактерий, большинство митохондриальных и хлоропластных ДНК, геномы
вирусов млекопитающих представлены единственной ковалентно замкнутой кольцевой дуплексной
молекулой ДНК. Хромосома бактериофага λ на
разных стадиях жизненного цикла существует то как
линейная молекула, то как замкнутая кольцевая
структура, то как кольцо с разрывами. По-видимому, никакого верхнего предела для размера
кольцевой двухцепочечной молекулы ДНК не существует.
ДНК в клетке обычно находится в комплексе
с белками (см. разд. 1.1.ж). Связанный белок слегка
раскручивает спираль ДНК, соответственно и число
витков спирали на единицу длины становится
меньше, чем у свободной В-ДНК. При удалении
белка восстанавливается обычное число правозакрученных (положительных) витков спирали. В
линейной молекуле ДНК это происходит достаточно легко, поскольку обе цепи свободно вращаются одна вокруг другой. В замкнутой же кольцевой молекуле общее число витков спирали топологически фиксировано, и число оборотов одной цепи
вокруг другой не может быть изменено без компенсаторного образования витков противоположного знака где-нибудь в другом месте молекулы.
Итак, когда естественные кольцевые дуплексы освобождаются от белков, с которыми они часто бывают связаны in vivo, происходит следующее:
1) число правозакрученных (положительных) витков спрали возрастает до величины, характерной
для В-ДНК; 2) в самом дуплексе образуется
столько же витков противоположного знака, чтобы
компенсировать увеличение скрученности спирали.
О таких молекулах говорят, что они обладают
отрицательной сверхспиральностью (рис. 1.10). При
внесении одного разрыва в сверхспиральную кольцевую ДНК сверхспиральность снимается и кольцевая структура переходит в релаксированное состояние, при котором топологические ограничения
отсутствуют. Любые химические или физические
изменения, приводящие к уменьшению числа витков
спирали на молекулу, уменьшают или вообще снимают отрицательную сверхспиральность в замкнутой кольцевой ДНК.
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
46
А
Б
РИС. 1.9.
Схематическое представление и электронные микрофотографии линейной (А) и кольцевой (Б) двухцепочечной
ДНК фага λ. (Электронные микрофотографии любезно
предоставлены L. Chow.) ДНК изображена в виде двойной спирали; такое же изображение для двухцепочечной
ДНК будет использоваться повсюду в этой книге.
Не все ДНК in vivo являются двухцепочечными.
Геномы некоторых мелких вирусов бактерий, растений и животных представляют собой ковалентно
замкнутые кольца, состоящие только из одной цепи
(рис. 1.11). Все известные одноцепочечные кольцевые ДНК относительно малы: ДНК бактериофагов
φХ174 и М13 содержат примерно 5300 и 6000 нук-
Кольцо
с разрывом
в одной цепи
леотидов соответственно и имеют длину 1,5–2 мкм;
длина молекул ДНК парвовирусов животных и некоторых вирусов растений составляет 2/3 и 1/2
указанных величин соответственно. Однако для
репликации любой из этих вирусных ДНК совершенно необходимо превращение одноцепочечного
кольца в соответствующее двухцепочечное, из ко-
Частично
денатурированное
кольцо
Сверхспиральное
кольцо
А
РИС. 1.10.
А. Схематическое изображение сверхспиральной кольцевой ДНК и релаксированных кольцевых форм, полученных либо в результате разрыва одной из двух цепей,
либо в результате локального расхождения двух цепей.
Б
Б. Двухцепочечная кольцевая ДНК фага М13 с разной
степенью сверхспиральности. Цифрами обозначено
число сверхвитков в каждой молекуле. (С любезного
разрешения L. Chow.)
47
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
Одноцепочечная
Нагревание
Двухцепочечная
Охлаждение
Нагревание
Нагревание
Охлаждение
Охлаждение
Одноцепочечная
Нативная
ДНК
Двухцепочечная
А
Частично
денатурированная
ДНК
Почти полностью
денатурирования
ДНК
торого затем образуются одноцепочечные кольцевые ДНК вирусного потомства (гл. 2). Более того,
экспрессия генетической информации в таких геномах всегда осуществляется в фазе двухцепочечной
ДНК, поскольку именно она является субстратом
для транскрипции последовательности ДНК в РНК.
Степень денатурации ДНК
РИС. 1.11.
Электронные микрофотографии одно- и двухцепочечных кольцевых ДНК фага М13. Двухцепочечная ДНК
выглядит более гладкой и вытянутой и ее легче визуализировать, чем одноцепочечную. (С любезного разрешения L. Chow.)
е. Денатурация и ренатурация ДНК
РИС. 1.12.
А. Денатурация (диссоциация) двухцепочечной ДНК при
повышении температуры раствора и ренатурация (реассоциация) двух комплементарных цепей при охлаждении. Б. Кривые денатурации типичной двухцепочечной
ДНК, получаемые при повышении температуры и рН. Тт
и рНm - это значения температуры и рН соответственно,
при которых ДНК денатурирована (или ренатурирована) наполовину.
Температура
Степень денатурации ДНК
Водородные связи и межплоскостные взаимодействия, стабилизирующие двойную спираль, достаточно слабы, и при относительно небольших
воздействиях происходит разделение цепей – процесс, именуемый денатурацией, или плавлением
(рис. 1.12, А). Двухцепочечная спиральная ДНК в
растворе легко разрушается при нагревании до температур, близких к 100°С. Денатурация происходит
также при увеличении рН раствора до уровня, при
котором разрушаются водородные связи между
основаниями. Многие факторы (например, однои двухвалентные катионы, полиамины и белки)
Б
pН
48
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Высокая
концентрация
соли
Гуанин + Цитозин, %
Низкая
концентрация
соли
Tm,°C
РИС. 1.13.
Зависимость Tm от молярного содержания гуанина и цитозина в ДНК при низкой и высокой концентрации соли.
Точки отвечают индивидуальным ДНК бактерий, бактериофагов, дрожжей, растений и животных. [J. Marmur,
P. Doty, J. Mol. Biol., 5 (1962), p. 109.]
влияют на денатурацию, нейтрализуя частично или
полностью отрицательно заряженные фосфатные
группы остова молекулы. Интервал значений тем-
пературы или рН, при которых происходит разделение цепей, очень невелик (см. рис. 1.12, Б, где Тт
и рНm – средняя точка перехода). Поскольку для
разрушения двух водородных связей АТ-пар требуется меньше энергии, чем для разрыва трех водородных связей GС-пар, значения температуры
и рН, при которых происходит денатурация, зависят
от нуклеотидного состава ДНК. Чем выше содержание GС-пар, тем выше Тт или рНm (рис. 1.13).
Денатурация – процесс обратимый, последующее
восстановление двухцепочечной структуры ДНК может происходить даже при полном расхождении цепей. Процесс воссоединения, называемый ренатурацией, реассоциацией или отжигом, происходит при
понижении температуры или рН (рис. 1.12). Если
температура или рН понижаются постепенно, то цепи соединяются правильно, с восстановлением всех
исходных пар оснований. При резком понижении
температуры или рН правильное воссоединение
комплементарных цепей затрудняется из-за спаривания оснований локально комплементарных
участков в пределах одной или разных цепей
(рис. 1.14). Диссоциация (денатурация) и реассоциация (ренатурация) ДНК в растворе являются по
сути искусственным
воссозданием процессов,
играющих ключевую роль в реализации разнообразных биологических функций in vivo. Очень важным для дальнейшего изложения представляется то,
что способность двух отдельных комплементарных
цепей нуклеиновой кислоты воссоединяться с образованием исходной структуры является ключевым
моментом для проведения соответствующих опы-
Плавное изменение
Резкое изменение
РИС. 1.14.
Ренатурация комплементарных цепей ДНК при плавном
(слева) и резком (справа) понижении температуры или
рН раствора.
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
тов in vitro, а также для выделения, сравнения
и идентификации специфических нуклеиновых кислот. Уникальная способность нуклеиновой кислоты
образовывать двойные спирали путем ассоциации
одиночных комплементарных цепей имеет огромное
значение для самых разных областей генетики.
ж. Упаковка ДНК в хромосомах
В клетках или вирусах ДНК, по-видимому, никогда не находится в свободной, вытянутой форме.
Она связана с низкомолекулярными катионами –
ионами двухвалентных металлов либо с ди- и полиаминами или белками, а возможно, с теми и с
другими. Взаимодействие осуществляется с помощью электростатических сил – отрицательно заряженные фосфатные группы частично нейтрализуются положительно заряженными ионами металлов и полиаминами или основными аминокислотными остатками белков. В результате таких
взаимодействий происходит конденсация ДНК с
уменьшением объема, занимаемого молекулой,
иногда в тысячу раз. Кольцевая ДНК Е. coli длиной
1,4 мм заключена в клетку, имеющую форму палочки диаметром 1 мкм и длиной 2 мкм; у эукариотических клеток ядерная ДНК длиной почти 2 м
в стадии интерфазы заключена в ядре диаметром
менее 10 мкм. Ядерная ДНК в клетках, находящихся в стадии митоза, конденсирована еще больше
и в световом микроскопе имеет вид очень компактной структуры (рис. 1.7).
Хромосомы эукариот. Хромосомы эукариотических клеток состоят в основном из хроматина –
комплекса двухцепочечной ДНК и пяти гистоновых
белков, обозначаемых H1, Н2А, Н2В, Н3 и Н4
(табл. 1.4). Гистоны могут быть ацетилированы,
метилированы, фосфорилированы, роlу(АDР)-рибозилированы, а гистоны Н2А и Н2В – ковалентно
связаны с белком, называемым убиквитином. Какова роль воздействия указанных компонентов на
структуру и функции гистонов – до конца не выяснено. Гистон H1 млекопитающих состоит из примерно 215 аминокислот; размеры других гистонов
варьируют от 100 до 135 аминокислот. Все они
содержат необычно большое количество положиТаблица1.4. Типичные характеристики гистонов
млекопитающих
Тип
H1 (кролик)
Н2А (корова)
Н2В (корова)
Н3 (корова)
Н4 (корова)
Число
аминокислот
213
129
125
135
102
Мол. Число
масса. основных
кДа аминокислот
Отношение
Lys/
/Arg
23,0
14,0
13,8
15,3
11,3
21
1,2
2,5
0,7
0,8
65
26
28
32
26
Число
кислых
аминокислот
12
20
16
18
10
49
тельно заряженной аминокислоты лизина; Н3 и Н4
отличаются от других тем, что у них достаточно
высок уровень положительно заряженной аминокислоты аргинина. Соотношение между Н2А, Н2В, Н3
и Н4, содержащимися в хроматине низших эукариот
(дрожжи, плесневые грибы), такое же, как в хроматине млекопитающих.
На электронно-микроскопических фотографиях
в зависимости от условий выделения и степени
растяжения хроматин выглядит либо как длинное
волокно диаметром 10 нм, либо чаще как более
вытянутое волокно с утолщениями – «бусинками»
диаметром 10 нм, нанизанными по всей длине волокна с определенными интервалами (рис. 1.15).
Каждая из этих бусинок представляет собой нуклеосомный кор, на который намотан сегмент хромосомной ДНК длиной 145 пар оснований. Кор –
это гистоновый октамер, состоящий из гистонов
Н2А, Н2В, Н3 и Н4, по две молекулы каждого вида
(рис. 1.16). Молекула ДНК, обвиваясь 1 3 / 4 раза
вокруг нуклеосомного кора, образует сверхспираль.
Пятый гистон, H1, не входит в состав нуклеосомного кора и не участвует в процессе наматывания
ДНК на гистоновый октамер. Он контактирует
с ДНК в тех местах, где двойная спираль входит
и выходит из нуклеосомного кора (рис. 1.17). В
такой структуре с одним гистоновым октамером
и молекулой гистона H1 ассоциированы 168 пар
оснований спиральной ДНК. Как мы уже отмечали,
на электронно-микроскопических фотографиях
хроматин часто обнаруживается в двух альтернативных формах: в форме волокна с четко разделенными нуклеосомами (нуклеосомы имеют вид
бусинок, нанизанных на нитку) или в форме волокна
диаметром 10 нм, в котором нуклеосомы упакованы бок о бок по всей его длине (рис. 1.15).
Волокно диаметром 10 нм может подвергаться
дальнейшей конденсации с образованием структур
более высокого порядка. При этом нуклеосомы, по
всей видимости, образуют соленоид – структуру
диаметром 30 нм (рис. 1.18).
В результате взаимодействия ДНК с гистонами
сегмент двойной спирали ДНК из 168 пар оснований
со средним диаметром 2 нм и длиной 57 нм превращается в спираль диаметром 10 нм и длиной
5 нм (рис. 1.18). При последующем сжатии этой
спирали до волокна диаметром 30 нм степень
конденсации увеличивается еще в шесть раз. Таким образом, упаковка дуплекса ДНК с пятью
гистонами приводит к 50-кратной конденсации
ДНК. Однако даже столь высокая степень конденсации не может объяснить почти 5000-кратное уплотнение ДНК в метафазной хромосоме.
Эукариотический хроматин содержит и другие
белки, которые обычно называют негистоновыми.
Некоторые из них, например ферменты, необхо-
50
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
А
Б
РИС. 1.15.
Электронные микрофотографии хроматина. А. Волокно
хроматина диаметром 10 нм из почечных клеток CV1
обезьяны. (С любезного разрешения J. Griffith.) Б. Хро-
матин из эритроцитов цыпленка, имеющий вид нити
с нанизанными на нее бусинками. (С любезного разрешения Н. Zentgraf.)
РИС. 1.16.
Модель нуклеосомного кора, построенная по данным
кристаллографического анализа низкого и высокого
разрешения. Сегмент ДНК (145 пар оснований), изображенный в виде трубки, обвивает гистоновый октамер, делая вокруг него 13/4 оборота. [R. D. Kornberg,
A. Klug, Sci. Amer., 244 (2) (1981), p. 52.]
РИС. 1.17.
Гистон Н1 «сшивает» ДНК в местах, где она начинает
и прекращает наматываться на нуклеосомный кор.
[A. Klug, Les Prix Nobel (Stockholm, Sweden, Nobel
Foundation, 1982), p. 93.]
51
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
Полностью
конденсированная
структура
Частично
конденсированная
структура
Н1
Неконденсированная
структура
РИС. 1.18.
ДНК
Структура хроматина с разной степенью конденсации.
В нижней части рисунка представлен хроматин, находящийся в растянутой форме; он имеет вид нити с нанизанными на нее бусинками. Далее изображен хроматин
в частично конденсированной форме, представляющий
собой волокно диаметром 10 нм. В верхней части рисунка представлен хроматин в наиболее конденсированном состоянии, когда волокно диаметром 10 нм
образует соленоид диаметром 30 нм. Обратите внимание на взаимодействие молекул гистона Н1, связанных
с каждой нуклеосомой, которое способствует конденсации волокна диаметром 10 нм в более плотную структуру. [Электронные микрофотографии любезно предоставлены A. Klug. Рисунок выполнен по R.D. Kornberg,
A. Klug, Sci. Amer., 244 (2) (1981), p. 52.]
димые для репликации и экспрессии ДНК, могут
связываться с хроматином временно. Белки, принимающие участие в различных процессах регуляции, связываются с ДНК только в специфических
тканях или на определенных стадиях дифференциации. Все эти вопросы, а также роль альтернативных способов организации хроматина в процессах репликации и экспрессии мы детально рассмотрим в последующих главах.
Хромосомы прокариот. Насколько известно, в
упаковке прокариотической геномной ДНК участвуют только два или три белка. О природе взаимодействия этих белков с ДНК и о структуре конденсированного комплекса белок-нуклеиновая кислота
известно немного. У Е. coli, по-видимому, существует лишь один белок или один класс ДНК-связывающих белков, называемых HU-белками; по
своему размеру, содержанию лизина и аргинина,
антигенным свойствам они сходны с эукариотическим гистоном Н2А. Другой белок, белок II, обна-
52
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
руженный у Е. coli и цианобактерий, по повышенному содержанию лизина и ДНК-связывающим
свойствам также напоминает эукариотический гистон. Белки HU и II обнаружены в количествах,
достаточных для образования комплекса по крайней
мере с половиной ДНК Е. coli и, по-видимому,
совместно с полиаминами и еще неизвестными нам
белками могут осуществлять те же самые функции
при конденсации и упаковке ДНК, что и пять
эукариотических гистонов.
1.2. СТРУКТУРА И ПОВЕДЕНИЕ РНК
а. Типы РНК и их распространенность
Содержание РНК в любых клетках в 5–10 раз
превышает содержание ДНК. Основная роль РНК
состоит в трансляции генетической информации с
образованием белков. Однако молекулы РНК принимают участие и в осуществлении некоторых специализированных эндонуклеазных функций, возможно регулирующих различные этапы экспрессии
генов. Молекулами РНК представлены геномы некоторых вирусов (ретровирусов и множества вирусов животных, растений и насекомых с одно- и двухцепочечным геномом).
Во всех клетках присутствуют следующие виды
РНК: рибосомная РНК (рРНК), транспортная РНК
(тРНК) и информационная, или матричная, РНК
(мРНК). Большинство (если не все) клеток содержат
также много других малых цитоплазматических
РНК (мцРНК), а в клетках эукариот присутствует
еще и множество малых ядерных РНК (мяРНК)
(табл. 1.5). Около 80% массы клеточных РНК составляют три или четыре вида рРНК, а около
15% – почти 100 видов тРНК. На долю нескольких
тысяч различных матричных РНК приходится менее
5% клеточной РНК, а на долю малых ядерной
и цитоплазматической РНК, число видов которых
пока неизвестно,– менее 2% от общего количества.
б. Компоненты молекулы РНК
и соединяющие их химические связи
РНК – это полинуклеотид длиной от 70 мономерных единиц у некоторых тРНК до 10000 и более
у некоторых мРНК. На рис. 1.19 приведены структурные формулы четырех нуклеотидов, обычно
встречающихся в РНК. Два пурина (аденин и гуанин) и один пиримидин (цитозин) входят также
в состав ДНК. А вместо тимина (5-метилдикетопиримидина) в РНК входит урацил, у которого
5-метильная группа отсутствует. Нуклеотиды в молекуле РНК соединены в цепочку такими же
5'–3'-фосфодиэфирными связями, как и в ДНК
(рис. 1.20). Из-за наличия 2'-ОН-группы связь Р–О
Таблица 1.5. Некоторые основные РНК
Тип РНК
Приблизительное число
разных видов
в клетках
Транспортная РНК
80-100
(тРНК)
Рибосомная 5S-PHK
1-2
(рРНК)
Рибосомная 5,8S-PHK
1
(рРНК)
Рибосомная 16S-PHK
1
(рРНК)
1
Рибосомная 23S-PHK
(рРНК)
Рибосомная 18S-PHK
1
(рРНК)
1
Рибосомная 28S-PHK
(рРНК)
Матричная РНК (мРНК) Тысячи
»
Гетерогенная ядерная
РНК (гяРНК)
Малая цитоплазматиДесятки
ческая РНК (мцРНК)
»
Малая ядерная РНК
(мяРНК)
1)
РасПриблизипротельная длина стра(число нукненность1)
леотидов)
75-90
П, Э
120
П, Э
155
Э
1600
П
3200
П
1900
Э
5000
Э
Варьирует
П, Э
Э
90-330
П, Э
58-220
Э
»
П - прокариоты, Э - эукариоты.
чувствительна к действию щелочей и ферментов,
расщепляющих РНК.
Некоторые пурины и пиримидины в РНК модифицированы: они содержат метил-, тиол-, водороди изопентенил-заместители. В РНК присутствуют
2'-О-метилнуклеотиды с модифицированным остатком рибозы, а также может наблюдаться иной
способ связывания между урацилом и рибозой (так
называемая псевдоуридиловая кислота) (рис. 1.21).
Такие модифицированные нуклеотиды довольно
редко встречаются в рРНК и мРНК и достаточно
часто – в тРНК. Как правило, модификация оснований и рибозных остатков происходит после завершения синтеза РНК, а не на стадии биосинтетических предшественников. Функциональное значение этого явления установлено лишь отчасти.
в. Структура РНК
Большинство клеточных РНК – одноцепочечные
молекулы, хотя некоторые вирусные геномы (в том
числе геномы ретровирусов) представлены двухцепочечными РНК, напоминающими А-форму ДНК.
В одиночных цепях все время образуются короткие
53
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
5'-конец
Аденин
Аденозин-5'-фосфат
(AMP)
Гуанозин-5'-фосфат
(GMP)
Гуанин
Уридин-5'-фосфат
Цитидин-5'-фосфат
(UMP)
(СМР)
Урацил
РИС. 1.19.
Структурные формулы четырех рибонуклеотидов, обычно встречающихся в РНК.
внутримолекулярные двухцепочечные участки. Это
связано с тем, что в большинстве РНК имеются
небольшие комплементарные последовательности,
которые спариваются и образуют петли (рис. 1.22).
В таких двухцепочечных участках А спаривается с U,
a G с С; G может образовать пару и с U, но GU-пара
менее стабильна, чем стандартная пара GC, поскольку ее компоненты соединены двумя, а не
тремя водородными связями. Двухцепочечные области, образованные подобным образом, обычно
непротяженны и прерывисты, поскольку спаривающиеся участки редко бывают абсолютно комплементарными. Укладка большинства РНК может
происходить более чем одним способом, однако
биологическое значение образующихся при этом
изомеров установлено только в некоторых случаях.
Например, известно, что адекватная укладка некоторых вирусных РНК чрезвычайно важна для экспрессии генов, поскольку ответ на ключевые регуляторные сигналы зависит от конфигурации молекулы (разд. 3.11.е). Подобная зависимость функции
от упаковки молекулы наилучшим образом про-
Цитозин
РИС. 1.20.
З'-конец
Участок рибонуклеотидной цепи.
демонстрирована на примере тРНК. Несмотря на
разную нуклеотидную последовательность, третичная структура разнообразных тРНК весьма сходна,
и ее стабилизация, по-видимому, имеет огромное
значение для функционирования этих молекул
(рис. 1.23). Правильная терминация синтеза РНК
и созревание (процессинг) транскрипта тоже часто
зависят от характера укладки РНК.
54
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Псевдоуридин (ψ)
5-Метилуридинриботимидин (rТ)
5,6-Дигидроуридин
(DHU)
РИС. 1.21.
5-Метилцитидин
(5-mеС)
4-Тиоуридин
(4-thio U)
Инозин (I)
7
2
N-Метилгуанозин ( 2 m e G )
N- Метилгуаниловая
кислота
6
N-Метиладениловая
кислота
г. Денатурация и ренатурация РНК
Как и в случае ДНК, двухцепочечные участки
в РНК разрушаются при повышении температуры
или рН, но, в отличие от ДНК, при высоких значениях рН в РНК разрушаются и фосфодиэфирные
связи. Поскольку протяженность спирализованных
участков в одноцепочечной РНК невелика, а сами
спирали несовершенны, разрушаются они довольно
легко. Однако полностью комплементарная двухцепочечная РНК плавится в довольно узком температурном интервале, как и двухцепочечная ДНК.
В результате денатурации образуются две комплементарные одиночные цепи, способные к последующему воссоединению при плавном понижении
температуры. После денатурации двухцепочечных
участков одноцепочечной РНК восстановление тех
же спаренных областей оказывается затрудненным,
и в результате ренатурации могут образоваться
структуры, отличные от исходной.
д. Гибридные
Структурные формулы модифицированных пуриновых
и пиримидиновых нуклеозидов, в небольших количествах встречающихся в некоторых РНК.
спирали
ДНК-РНК
Полинуклеотидные цепочки РНК и ДНК,
имеющие комплементарные последовательности,
могут образовывать двойную спираль РНК–ДНК
с антипараллельными цепями. Структура таких
комплексов напоминает А-ДНК (рис. 1.8). Спаривание оснований в них отвечает правилам Уотсона-Крика для ДНК: dA спаривается с rU, rA – c
dT, dG – c rC и dC – c rG. В дуплексах РНК–ДНК
пара оснований rG•dC более стабильна, чем пара
dG•rС, и обе они стабильнее пар dG•dC в ДНК; обе
пары, dT•rА и rU•dA, менее стабильны, чем пара
dA•dT в ДНК. Гибридные спирали, или гетеродуплексы, способны к денатурации и ренатурации, как
и дуплексы ДНК. В водных растворах с умеренной
концентрацией солей двухцепочечные комплексы
РНК-ДНК денатурируют легче, чем соответствующие спирали, состоящие исключительно из цепей РНК и ДНК. В растворах же, содержащих
формамид и соли в определенных концентрациях,
дуплекс РНК–ДНК стабильнее дуплекса ДНК. Эти
условия могут использоваться для образования и
специфической стабилизации гибридных дуплексов.
Полинуклеотидные цепи РНК или ДНК считаются комплементарными, если они способны
образовать протяженную двойную спираль с уотсон-криковскими парами оснований. Две нуклеиновые кислоты можно назвать гомологичными, если
их нуклеотидные последовательности идентичны
или очень близки. Гомологичность двух нуклеино-
55
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
РИС. 1.22.
5'-концевой сегмент 16S-pPHK E.
соli. Видно, что благодаря внутримолекулярному спариванию оснований
происходит укладка цепи. Заметим,
что в стабилизации дуплексной структуры РНК участвуют G•U-пары. Несколько оснований могут образовывать петлю, если в противоположной
цепи отсутствуют комплементарные
основания. Цветом выделены первое
основание цепи и место продолжения цепи в З'-направлении. (С любезного разрешения Н. Noller.)
РИС. 1.23.
Структура тРНК Аsр и тРНК Рhe , воссозданная с помощью компьютерной графики.
Остов каждой цепи РНК имеет вид
сплошной трубки. Такая компактная
структура стабилизируется благодаря
спариванию оснований, далеко отстоящих друг от друга в нуклеотидной последовательности. 5'- и З'-концы цепей
РНК находятся в правом верхнем углу
структуры. (Модели и фото предоставлены Arthur J. Olson, Ph. D. Copyright
1987, Research Institute of the Scripps
Clinic.)
asp-тРНК
phe-тРНК
56
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
вых кислот можно определить по степени образования двойных спиралей соответствующими одиночными цепями РНК, ДНК или гибридов РНК–ДНК.
За образованием ДНК-, РНК- и гибридных РНКДНК-спиралей можно следить разными способами.
В качестве зонда для выявления и количественного
анализа гомологичных молекул РНК часто используется одноцепочечная ДНК. Так, степень превращения одноцепочечной РНК в двухцепочечную
форму в присутствии другой нуклеиновой кислоты
является мерой гомологичности их последовательностей. Используя соответствующего партнера по
гибридизации, можно установить протяженность
специфической нуклеотидной последовательности
и гомологичность двух ДНК, РНК и ДНК, а также
двух РНК.
1.3. СТРУКТУРА БЕЛКОВ
а. Компоненты белков
и соединяющие их химические связи
Белки состоят из одной или нескольких полипептидных цепей, каждая из которых в свою очередь
представляет собой длинный неразветвленный полимер, состоящий из аминокислот. Все полипептиды независимо от источника – от вирусов до человека – построены из 20 разных аминокислот. В
аминокислотах имеются как одинаковые для всех,
так и уникальные химические группировки: атом
углерода (α-углеродный атом), несущий карбоксильную и амино-группы. и определенные заместители, характерные для каждой аминокислоты
(рис. 1.24). Такие «боковые цепи», часто называе-
Аланин
(A; Ala)
Аргинин
(R; Arg)
Аспарагин
(N; Asn)
Аспарат
(D; Asp)
Цистеин
(С; Cys)
Глицин
(G; Gly)
Гистидин
(H; His)
Изолейцин
(I; Ile)
Лейцин
(L; Leu)
Лизин
(K; Lys)
РИС. 1.24.
Пролин
(Р; Pro)
Серин
(S; Ser)
Треонин
(T; Tre)
Структурные формулы аминокислот, обычно встречающихся в белках. Вариабельная часть аминокислот выделена цветом. Под формулами даны полное название
аминокислот, одно- и трехбуквенные обозначения. Очень
Триптофан
(W; Trp)
Глутамин
(Q; Gln)
Метионин
(M; Met)
Тирозин
(Y; Tyr)
Глутамат
(E; Glu)
Фенилаланин
(F; Phe)
Валин
(V; Val)
часто при изображении пептидной или полипептидной
цепи боковые группы аминокислот обозначают буквой
R.
57
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
Дипептид
N-конец
Плоская пептидная
группа
С-конец
РИС. 1.25.
Структура дипептида. В верхней части рисунка показано, как образуется пептидная связь. Представлены заряженные концевые амино- и карбоксильная группы
и α-углеродные атомы, к которым присоединены боковые группы. В нижней части рисунка указаны углы
вращения (ψ и φ), характерные для пептидных групп.
R-группы и атомы водорода, связанные с α-углеродными атомами, выступают из плоскости рисунка вверх
или вниз.
мые R-группами, различаются по размеру, форме,
заряду и химической активности.
Остов любой белковой цепи образуется с помощью амидных (или пептидных) связей, соединяющих аминогруппу одной аминокислоты с карбоксильной группой другой, соседней аминокислоты. На рис. 1.25 показано простейшее полипептидное звено – дипептид, а на рис. 1.26 представлены
геометрия полипептидной цепи и положение различных заместителей гептапептида. Таким образом,
полипептиды – это длинные цепи, образуемые с
помощью регулярно повторяющихся пептидных
связей и содержащие набор боковых групп, распоN-концевой
остаток
Пептидные связи
ложенных вдоль остова. Полипептидная цепь имеет
определенное направление. На одном ее конце находится свободная аминогруппа (в нейтральных
условиях эта группа протонируется с образованием
+
NH3 ); соответствующая аминокислота называется
N-концевой, такое же название – и у данного конца
цепи. На другом конце цепи находится карбоксиль–
ная группа, обычно существующая в виде СОО –
аниона; аминокислота в этой позиции называется
С-концевой, такое же название имеет и соответствующий конец цепи. В некоторых белках между
цистеиновыми остатками одной цепи образуются
дисульфидные связи, объединяя разные участки цепи (рис. 1.27). Такие дисульфидные мостики могут
объединять и разные полипептидные цепи независимо от того, идентичны они или нет. Полипептидные субъединицы некоторых олигомерных белков объединены именно таким образом.
В некоторых белках встречаются в небольших
количествах модифицированные формы природных
аминокислот (рис. 1.28). Практически во всех случаях изменения в структуре аминокислот происходят лишь после образования пептидных связей:
в результате гидроксилирования уже включенных в
белок пролина и лизина получаются гидроксипролин и гидроксилизин соответственно; при карбоксилировании глутамата образуется γ-карбоксиглутамат, а при фосфорилировании гидроксильных групп
серина и треонина или фенольной группы тирозина – фосфоаминокислоты.
Важными компонентами эукариотических клеток
и многих вирусов являются белки, относящиеся
к группе гликопротеинов. Они содержат сложные
углеводы, ковалентно связанные с входящими в
состав белка аспарагиновым, гидроксилизиновым,
сериновым и треониновым остатками. Как и в случае модификации аминокислот, описанном выше, на
определеных этапах, следующих за сборкой полипептидной цепи, к ней могут присоединяться различные сахара (разд. 3.10). Реакции гликозилирования играют важную роль в процессах транспортировки белков от места их синтеза в специфические
клеточные органеллы и к поверхностным структурам клетки; гликопротеины также придают определенный рисунок поверхности клеток.
С-концевой
остаток
РИС. 1.26.
Структура гептапептида. Обозначения такие же, как на
рис. 1.25.
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
58
А-цепь
РИС. 1.27.
Дисульфидные связи, образующиеся между цепями и
в пределах одной цепи бычьего инсулина. А-цепь содержит два расположенных недалеко друг от друга
цистеиновых (Cys) остатка, которые образуют внутрицепочечную дисульфидную связь. Показаны также два
дисульфидных мостика, связывающих остатки цистеина
А- и В-цепей. Аминоконцевой фенилаланин (Phe)
В-цепи и карбоксиконцевой аспарагин (Asn) А-цепи
являются соответственно N- и С-концами полипептида предшественника инсулина.
В-цепь
б. Размер и форма белков
Гидроксилизин
Гидроксипролин
ДНК-лигаза
ДНК-полимераза I
Щелочная фосфатаза
Lac-репрессор
β-Галактозидаза
Глутаминсинтетаза
Гемоглобин
Триптофансинтаза
РИС. 1.28.
Р-треонин
Р-тирозин
Некоторые модифицированные аминокислоты, встречающиеся в белках.
Е. coli
Е. coli
Е. coli
Е. coli
Е. coli
Е. coli
Млекопитающие
Е. coli
Аспартат-транскарбамилаза
РНК-полимераза
(основной фермент)
Е. coli
Пируватдегидрогсназный комплекс
Е. coli
1)
Р-серин
Источник
2)
3)
4)
5)
Е. coli
75
109
86
160
544
592
64
1
1
2
4
4
12
2α
2β
2α
2β
Мол. масса
субъединиц, кДа
Белок
Число
субъединиц
γ-Карбоксиглутамат
Таблица 1.6. Размер и субъединичный состав
некоторых глобулярных белков
Мол. масса
белка, кДа
Размеры полипептидов очень сильно различаются: число составляющих их аминокислот колеблется от 50 до нескольких тысяч. Поскольку
с каждой аминокислотой масса белка увеличивается
примерно на 110 дальтон, мол. масса белков может
варьировать от 104 до 106 дальтон. Одни белки
состоят только из одной полипептидной цепи,
другие – из нескольких одинаковых цепей, третьи –
из нескольких цепей разного типа (табл. 1.6). При-
–
–
43
40
135
49
16
16
148
29
45
1)
310 6(С)
33
2)
17
6(R)
400
2(α) 40
1(β) 155
165
1(β')
4500 243)
91
4)
24
70
5)
12
56
Каталитические субъединицы.
Регуляторные субъединицы.
Пируватдекарбоксилазные субъединицы.
Дигидролипоилтрансацетилазные субъединицы .
Дигидролипоилдегидрогеназные субъединицы.
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
59
и растворимых белков имеют глобулярную структуру; такие белки, как коллаген и кератин, обнаруживаемые в структурных и соединительных тканях, принимают фибриллярную конформацию.
Фибриноген и мышечный миозин могут встречаться как в одной, так и в другой форме.
в. Чем определяется
конформация белка
РИС. 1.29.
Пространственная модель глобулярного белка гексокиназы. Вверху показаны молекула гексокиназы и один из
ее субстратов, D-глюкоза, в свободном состоянии. После связывания глюкозы домены белка (темный и светлый цвета) сближаются и закрывают карман, в котором
находится центр связывания. [W.S. Bennett, Jr.,
Т.А. Steitz, J. Mol. Biol., 140 (1980), p. 211.]
мером белка, представленного одной полипептидной цепью, служит миоглобин; глутаматсинтетаза
бактерий содержит 12 идентичных полипептидных
цепей. Гемоглобин – тетрамер, состоящий из цепей
двух разных видов, а функциональная форма
ДНК-полимеразы Е. coli состоит из полипептидных
цепей по крайней мере четырех разных видов.
В растворе белки имеют строго определенную
конформацию, или трехмерную структуру. Биологическая активность почти всех без исключения
белков, будь то белки-катализаторы, структурные
белки, белки, ответственные за транспортные процессы, белки, участвующие в формировании опорно-двигательного аппарата, или белки-регуляторы,
зависит от сохранения их природной, или активной,
конформации. Белки в соответствии с их конформацией можно разделить на две категории. Глобулярные белки имеют компактную, примерно сферическую форму, образующуюся в результате нерегулярной укладки полипептидных цепей (рис. 1.29).
В фибриллярных белках полипептидные цепи располагаются параллельно друг другу, образуя длинные
нити или слои (рис. 1.30). Большинство ферментов
Структуру белка можно рассматривать на разных уровнях организации – на уровне первичной,
вторичной, третичной или четвертичной структуры.
Первые три относятся к структурным характеристикам полипептидных цепей, четвертый отражает
структуру олигомерных белков, состоящих из двух
или более полипептидных цепей.
Каждый белок обладает уникальной аминокислотной последовательностью (см. рис. 1.27, на котором показана аминокислотная последовательность
двух цепей бычьего инсулина); порядок расположения аминокислот вдоль полипептидной цепи
называется первичной структурой. Уникальность
первичной структуры впервые была выявлена при
исследовании бычьего инсулина, а затем подтверждена в результате анализа тысяч других белков
разного размера. Первичная структура белка детерминируется первичной структурой соответствующего гена. Поэтому при изменении нуклеотидной последовательности гена, кодирующего данный
белок, изменяется и первичная структура белка.
Полипептидные цепи могут укладываться в регулярные структуры, называемые вторичными.
Наиболее часто встречающимися периодическими
конформациями белков являются правозакрученная
α-спираль и β-слой. В α-спирали остов имеет конфигурацию винтовой спирали с периодичностью
0,54 нм и примерно 3,6 аминокислотными остатками на виток (рис. 1.31). Стабилизация спиральной
структуры осуществляется благодаря образованию
водородных
связей
между
атомом
водорода
NH-группы одной аминокислоты и СО-группой
четвертой вдоль цепи аминокислоты. Боковые
группы аминокислот располагаются на наружной
стороне спирали (рис. 1.32). Длина участка данной
полипептидной цепи, который может принимать
α-спиральную конфигурацию, зависит от аминокислотного состава и аминокислотной последовательности цепи. Некоторые аминокислоты или
последовательности дестабилизируют α-спираль, а
если в цепи встречается пролин или гидроксипролин,
то α-спираль прерывается из-за ограничения вращения вокруг пептидной связи и отсутствия атома
водорода для образования водородной связи. Как
правило, α-спиральные участки относительно непротяженны и состоят в среднем из 10–20 амино-
60
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
А
Участок фибриллы
коллагена
Тройная спираль
Б
В
РИС. 1.30.
Структуры коллагена. А. Электронная микрофотография интактных фибрилл коллагена кожи. (С любезного
разрешения J. Cross.) б. Тропоколлагеновые волокна,
состоящие из трех полипептидных цепей, сплетенных
в тройную спираль. В. Фибриллы образуются путем
взаимодействия между несколькими тропоколлагеновыми тройными спиралями.
кислот. Иногда водородные связи, образующиеся
между боковыми группами аминокислот в двух
α-спиральных сегментах, соединяют расположенные
бок о бок витки спирали одной и той же или разных
полипептидных цепей, и тем самым структура еще
больше стабилизируется. Известны случаи (примером может служить фибриноген), когда множест-
венные α-спиральные сегменты одной полипептидной цепи образуют беспорядочные пучки. У некоторых белков, в частности у фермента химотрипсина, α-спиральные области отсутствуют; у других,
например у α- и β-субъединиц гемоглобина, α-спирали встречаются вдоль цепи довольно часто.
Другой тип вторичной структуры белков –
61
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
А
Б
РИС. 1.31.
В
Различные модели правозакрученной а-спирали. А. Показаны только α-углеродные атомы. Б. Показаны только
скелетные атомы азота (N), α-углеродные атомы
(Сα) и атомы углерода карбонильных групп (С). В.
Показана спираль в целом. Ее стабилизируют водородные связи между NH- и СО-группами. [L. Stryer, Biochemistry (San Francisco, W.H. Freeman, 1981).]
β-слой, названный так потому, что структура напоминает полотно. В β-слое в отличие от α-спирали, в которой полипептидная цепь скручена и
образует структуру, имеющую форму стержня, полипептидная цепь растянута. Водородные связи в
β-слое образуются между отдаленными друг от
друга аминокислотами одной полипептидной цепи
или между аминокислотами из разных цепей
(рис. 1.33). Ряды из двух-пяти цепей, скрепленных
водородными связями, находящиеся в параллельной друг другу или антипараллельной ориентации,
образуют структуру, напоминающую гофрированную ткань.
Некоторые белки (в частности, коллаген) содержат необычайно много глицина и пролина – тех
двух аминокислот, которые дестабилизируют или
разрушают α-спирали, а также две необычные аминокислоты – гидроксипролин и гидроксилизин. Подобные белки образуют вторичную структуру
третьего типа; она состоит из трех длинных левозакрученных спиралей, сплетенных в виде плотного
каната (рис. 1.34). Структура также стабилизируется водородными связями, образуемыми между
боковыми остатками прилегающих друг к другу
нитей каната.
Почти все ферменты и регуляторные белки
имеют глобулярную форму; это и есть их третичная
структура. Боковые цепи полярных аминокислот
локализуются на поверхности глобулы, контактирующей с растворителем, а боковые цепи неполяр-
62
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 1.32.
Вид на α-спираль сверху. R-группы аминокислот выступают из спирали. Для наглядности внутренняя часть
спирали дана в увеличенном виде. [L. Stryer, Biochemistry (San Francisco: W.H. Freeman, 1981).]
ных аминокислот упрятаны внутри и экранированы
от водной среды. Плотно скрученные полипептидные цепи содержат варьирующее число α-спиралей
и β-слоев, разделенных неструктурированными областями, как правило находящимися в местах изгибов остова (рис. 1.29 и 1.35). Биологически актив-
РИС. 1.33.
Структура β-слоя. β-Слой образуется из нескольких
полипептидных цепей. Его стабилизируют водородные
связи между атомами водорода амидных групп (NH)
одной цепи и атомами кислорода карбонильных групп
(СО) параллельной цепи. Обратите внимание, что вместо внутрицепочечных водородных связей, характерных
ная четвертичная структура белка поддерживается
с помощью разнообразных взаимодействий между
аминокислотами. К ним относятся: 1) взаимодействия, которые ответственны за формирование α-спиралей и β-слоев; 2) водородные связи между некоторыми боковыми группами аминокислот; 3) ионные связи между противоположно заряженными
боковыми группами; 4) ковалентные дисульфидные
связи между отдаленными друг от друга вдоль цепи
остатками цистеина; 5) гидрофобные взаимодействия между боковыми группами, более прочные, чем
взаимодействия с водной фазой на наружной поверхности белковой глобулы. Относительный вклад
всех этих сил в стабилизацию структуры у разных
белков варьирует.
При нагревании либо повышении или понижении
рН нативная глобула разворачивается (происходит
денатурация). Этот процесс обратим, т.е. третичная
структура может восстанавливаться с образованием
тех химических и физических взаимодействий, которые стабилизируют нативную компактную конформацию (ренатурация). Механизм правильного
свертывания полипептидной цепи и промежуточные
этапы этого процесса интенсивно изучаются.
Большинство глобулярных белков – олигомеры
(т.е. состоят из двух или более идентичных или
разных полипептидных цепей). Примером глобулярных белков могут служить гемоглобин (рис. 1.36)
и иммуноглобулин (рис. 1.37). Четвертичная структура подобных белков определяется тем, как взаимодействуют между собой в олигомерной структуре
отдельные свернутые полипептидные цепи. В гемоглобине, например, благодаря взаимодействию
аминокислот, входящих в состав α-спиралей и
β-слоев, образуется αβ-димер, а димеры в свою
для α-спирали, в β-слое образуются межцепочечные
водородные связи. В представленном здесь примере
полипептидные цепи параллельны, однако для некоторых β-слоев характерно антипараллельное расположение цепей.
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
РИС. 1.34.
Молекулярная структура коллагена. А. Основной повторяющийся структурный элемент, состоящий из остатков
глицина и двух остатков пролина. Б. Скелетная модель
трехцепочечной коллагеновой спирали. Каждая цепочка
состоит из нескольких повторяющихся структурных
элементов, указанных на рис. A. [L. Stryer, Biochemistry
(San Francisco: W.H. Freeman, 1981).] В. Пространственная модель коллагена II. Каждая цепочка состоит из
повторяющихся элементов глицин-пролин-гидроксипролин. Шаг спирали равен 2,86 нм. [A. Rich,
F.H.C. Crick, J. Mol. Biol., 3 (1961), p. 483.]
А
В
Б
63
очередь с помощью дополнительных взаимодействий объединяются в α2β2-тетрамер (рис. 1.36). Детальные исследования структуры гемоглобина позволили установить, как изменяются соответствующие взаимодействия при связывании этим белком кислорода.
Вторичная, третичная и четвертичная структуры
белков тесно связаны между собой и в конечном
счете определяются первичной структурой одной
или нескольких полипептидных цепей. Последствия
такой взаимосвязи очень значительны: информация,
определяющая укладку белковой молекулы и переход ее в биологически активное состояние, закодирована в его аминокислотной последовательности.
Подтверждением этого принципиального положения служит то, что химические модификации и
мутационные изменения аминокислотной последовательности полипептидов сильно влияют на их
ренатурацию и способность формировать вторичную, третичную и четвертичную структуры с полноценной биологической активностью.
В качестве одного из многочисленных примеров
зависимости структуры и функции белка от его
аминокислотной последовательности можно привести серповидноклеточную анемию. Генетическое
нарушение при этой болезни выражается в замене
глутаминовой кислоты, шестой по счету от N-конца
β-цепи в нормальном гемоглобине, на валин. Изменение в первичной структуре β-глобина приводит
64
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 1.35.
Схематическое изображение участка ДНК-полимеразы I
Е. соli. α-Спирали изображены в виде цилиндров,
β-слои - в виде стрелок. Чем интенсивнее окрашены эти
РИС. 1.36.
Модель гемоглобина, построенная при
низком разрешении. Гемоглобин - это
тетрамерный белок, состоящий из двух
α-цепей (α1 и α2) и двух β-цепей (β1
и β2). С каждой из цепей связана гемогруппа (выделена цветом; прямоугольник - гем, шарик - атом железа). (Copyright Irving Geis.)
элементы, тем ближе они расположены к читателю.
[D.L. Ollis et al., Nature, 313 (1985), p. 762.]
65
1. МОЛЕКУЛЫ ГЕНЕТИЧЕСКОГО АППАРАТА
Тяжелая цепь
Легкая цепь
А
Б
РИС. 1.37.
Структура иммуноглобулина. А. Иммуноглобулин состоит из четырех полипептидных цепей: двух идентичных легких и двух идентичных тяжелых. Структура стабилизируется с помощью дисульфидных связей, образующихся между двумя тяжелыми цепями и тяжелыми
и легкими. В самих тяжелых и легких цепях также
образуются дисульфидные связи. Б. Модель молекулы
иммуноглобулина, иллюстрирующая переплетение легких и тяжелых полипептидных цепей. [Е.W. Silverton,
М.А. Navia, D.R. Davies, Proc. Natl. Acad. Aci., USA, 74
(1977), p. 5140.]
66
ЧАСТЬ 1. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Б
А
РИС. 1.38.
Г
В
к тому, что на поверхности белковой глобулы оказывается аномальная гидрофобная аминокислота,
из-за чего происходит агрегация дезоксигенированного гемоглобина с образованием олигомерных
структур более высокого уровня организации
(рис. 1.38). В результате форма и пластичность
эритроцитов изменяются, и кровоток через капилляры и мелкие вены затрудняется или вовсе прекращается. Основной вывод, который можно сделать
Дефекты, возникающие на клеточном и молекулярном уровнях при серповидноклеточной анемии.
А. Микрофотография, на которой видны нормальный (2) и серповидный (1) эритроциты. (С
любезного разрешения S. Schreier.) Б. Гемоглобиновые волокна в разрушенном серповидном
эритроците. В. Поперечный разрез через гемоглобиновые волокна полученные при оксигенации серповидного гемоглобина. (Фото Б и В любезно предоставлены S.J. Edelstein.) Г. Электронная микрофотография неокрашенного тяжа серповидного гемоглобина. [G. Dykes, R.H. Crepeau,
S.J. Edelstein, Nature, 272 (1978), p. 509.]
из этого классического случая, состоит в том, что
одна-единственная мутация – замена нуклеотида в
последовательности ДНК, приводящая к замене
одной аминокислоты на другую в специфическом
сайте полипептидной цепи,– может оказывать столь
драматическое влияние на конформацию белка и его
физиологическую функцию. В более общем смысле,
таков механизм, связывающий генотипы всех организмов с их фенотипами.
Глава 2
РЕПЛИКАЦИЯ, СОХРАНЕНИЕ
И МОДИФИКАЦИЯ ГЕНОМА
Генетическая программа клеточных организмов
записана в нуклеотидной последовательности ДНК.
Следовательно, для сохранения уникальных свойств
организма необходимо точное воспроизведение
этой последовательности в каждом последующем
поколении. Е. coli, например, должна дуплицировать
практически без ошибок полный геном размером
4•106 нуклеотидных пар при образовании каждого
последующего поколения; точно так же должны
быть скопированы почти 4•109 пар оснований в 23
парах хромосом человека при каждом акте деления
клеток.
Одной из чудесных особенностей ДНК является
то, что в ней закодирована информация о механизме ее собственного удвоения: одни гены кодируют ферменты, синтезирующие нуклеотидные
предшественники ДНК, другие – белки, осуществляющие сборку активированных нуклеотидов в
полинуклеотидные цепочки. Есть гены, координирующие процесс репликации с другими клеточными
событиями, а также гены, кодирующие белки, которые упаковывают ДНК в хроматин. Еще одним
необычным свойством ДНК является то, что она
служит матрицей и определяет порядок, в котором
нуклеотиды выстраиваются в новые нуклеотидные
цепочки. Обладая одинаковым аппаратом синтеза,
различные ДНК осуществляют образование только
подобных себе реплик.
В генетической программе предусмотрены ферментативный
механизм, который исправляет
ошибки, иногда происходящие при репликации
ДНК, и механизм репарации повреждений, затрагивающих основания или спиральную структуру
при облучении рентгеновскими лучами и ультрафиолетовым светом или при воздействии различных
химических агентов, а также механизм устранения
дефектов, связанных с некоторыми заболеваниями.
Генетическая программа обеспечивает создание
геномных вариантов и возможность эволюционных
изменений. Определенные гены кодируют белки,
способствующие обмену цепями, принадлежащими
разным молекулам ДНК, и тем самым созданию
новых комбинаций
генетического
материала,
передаваемых потомству. Известны белки, вызывающие геномные перестройки путем катализа
транслокаций небольших сегментов или даже протяженных участков в пределах одной молекулы
ДНК и между молекулами. С одной стороны, ре-
комбинации и транслокации подобного рода создают основу для эволюционных экспериментов, а
с другой – некоторые перестройки могут быть причиной заболеваний. Как это ни странно, оптимальное функционирование некоторых генетических
программ действительно зависит от специфических
перестроек в ДНК (гл. 10).
В этой главе мы рассмотрим механизмы репликации, репарации, рекомбинации и перестроек – по
существу, генетические манипуляции на уровне
ДНК. В этой главе представлены также данные
о репликации вирусных РНК-геномов, поскольку
некоторые этапы этого процесса сходны с процессом репликации ДНК.
2.1. РЕПЛИКАЦИЯ ДНК
а. Матричная функция ДНК
при репликации
Обнародуя свою модель структуры ДНК в
1953 г., Джеймс Уотсон и Фрэнсис Крик писали:
«Мы не могли не осознавать, что специфическое
спаривание (оснований), постулированное нами,
подразумевает наличие какого-то механизма копирования генетического материала». И через месяц
они углубили эту мысль: «Если известен точный
порядок оснований в одной из цепей, то можно
записать и порядок оснований в другой, поскольку
спаривание оснований специфично. Таким образом,
одна цепь является комплементом другой; именно
это свойство наводит на мысль, что ДНК может
удваивать саму себя».
Уотсон и Крик предположили, что для удвоения
ДНК должны произойти разрыв водородных связей,
удерживающих вместе спиральный дуплекс, и расхождение цепей. Они также высказали мысль, что
каждая цепь дуплекса служит матрицей при синтезе
комплементарной цепи и в результате образуются
две пары цепей, в каждой из которых только одна
является родительской (рис. 2.1). Таков механизм
точного воспроизведения последовательности нуклеотидных пар в двойной спирали. Уотсон и Крик
полагали, что репликация ДНК осуществляется
спонтанно, без участия ферментов, но это оказалось
неверно. Тем не менее идея о том, что удвоение
ДНК происходит путем последовательного соеди-
68
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
разует дуплекс, а затем на этом дуплексе синтезируются либо дочерние дуплексы, либо одноцепочечные копии одной из матричных цепей (рис. 2.3).
б. Репликация начинается в
определенных точках
Старая
Новая
Новая
Старая
РИС. 2.1.
Перед дупликацией ДНК должны произойти разрыв
водородных связей, стабилизирующих двойную спираль, и расплетание цепей. Каждая цепь служит матрицей при синтезе другой, комплементарной цепи.
[J.D. Watson, F.H.C. Crick, Cold Spring Harbor Symposium, 18 (1953), p. 123.]
нения нуклеотидов в соответствии с правилом
комплементарности, заданным каждой цепью спирали, разрешила концептуальную проблему точного
воспроизведения генов.
С того времени, как было высказано это предположение, матричная природа механизма репликации была подтверждена многочисленными данными, полученными как in vivo, так и in vitro для
различных организмов. Согласно модели, репликация всех двухцепочечных ДНК полуконсервативна
(рис. 2.2). Существуют ли в природе альтернативные способы репликации двухцепочечной ДНК (например, консервативный или дисперсный) – неизвестно. Итак, после одного раунда репликации одна
цепь в каждой из двух дочерних молекул является
родительской, т.е. консервативной, а другая – синтезированной заново. Если геном представлен одноцепочечной ДНК (как в некоторых вирусах), то
эта единственная цепь служит матрицей для образования комплементарной цепи, с которой она об-
Начало репликации (origin). Репликация ДНК
начинается не в любой случайной точке молекулы,
а в специфических местах, называемых точками
начала репликации. Процесс копирования продолжается через образование репликативных вилок в
одном или обоих направлениях до тех пор, пока
ДНК полностью не удвоится (рис. 2.4). В замкнутых кольцевых дуплексах ДНК новосинтезированные цепи ковалентно соединяются в местах встречи
увеличивающихся в размере репликативных вилок
или в том месте, где единственная вилка возвращается к точке начала репликации. Дочерние молекулы, как правило, расходятся еще до начала нового
раунда репликации. Такие различающиеся по размеру геномы, как геном вируса SV40 (5,2 т.п.н.),
бактериофага λ (48,5 т.п.н.) и E. coli (4•103 т.п.н.),
воспроизводятся в результате одного инициирующего события, происходящего в определенной
точке.
У про- и эукариот можно встретить различные
вариации на эту тему. Так, каждая из цепей родительской спирали митохондриальной ДНК животных (15 т.п.н.) и ДНК плазмиды Col E1 (6 т.п.н.)
имеет свою точку начала репликации (рис. 2.5).
Синтез комплементарной цепи некоторых небольших одноцепочечных фаговых геномов начинается
вблизи одной специфической последовательности,
а репликация полученного дуплекса может инициироваться совсем в другой точке (рис. 2.6). Репликация линейных дуплексных ДНК также инициируется в особых сайтах. Например, ДНК бактериофага Т7 (40 т.п.н.) реплицируется в двух противоположных направлениях к разным концам молекулы, начиная от одной точки (рис. 2.7), а каждая
из двух цепей ДНК аденовируса человека (3038 т.п.н.) реплицируется последовательно всегда от
3'-конца (рис. 2.8).
Для геномов эукариотических клеток (рис. 2.9)
обычно характерно наличие множественных точек
начала репликации, разбросанных по хромосоме на
расстоянии 20 т.п.н. После инициации репликация
продолжается в двух направлениях от каждой точки
до тех пор, пока репликативные вилки двух соседних
точек начала репликации не сольются. Полноразмерные ДНК каждой дочерней хромосомы получаются путем соединения более коротких, независимо инициированных новосинтезированных цепей.
Скорость репликации генома. Скорость репликации генома регулируется в основном частотой
69
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
Родительская
молекула
Родительская
молекула
Родительская
молекула
F1
F1
F1
РИС. 2.2.
Предполагаемые модели репликации дуплексной ДНК.
В средней части рисунка представлен реальный, полуконсервативный механизм. Реализуются ли другие возможные механизмы, а именно - консервативный (слева)
и дисперсионный (справа),- неизвестно.
В
К
B
РИС. 2.3.
K
Репликация одноцепочечных вирусных ДНК. Буквой В
обозначен вирусный геном, буквой К - его комплемент.
K
B
B
B
B
B
B
70
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
ori
РИС. 2.4.
Репликация инициируется в специфическом участке
ДНК, называемом точкой начала репликации (ori). Растущие цепи образуют репликативные вилки. Синтез
новых дуплексов ДНК происходит в репликативных
вилках, перемещающихся либо в двух (вверху), либо
в одном (внизу) направлении в зависимости от природы
точки начала репликации.
инициирующих событий. Так, у Е. coli скорость
копирования в каждой репликативной вилке постоянна и равна примерно 1500 п.н. в секунду;
следовательно, полный геном длиной 4•106 пар
реплицируется примерно за 40 мин. Если хромосома реплицируется быстрее, это значит, что увеличивается частота актов инициации в той же самой
точке начала репликации при прежней скорости
копирования. Клетки Е. coli делятся каждые 20 мин;
это означает, что репликация ДНК инициируется
в хромосомах, еще не закончивших предыдущий
раунд репликации. Скорость движения репликативной вилки в эукариотических клетках значительно
меньше (10–100 п.н. в секунду), но завершение
репликации хромосомы в разумное время обеспечивается одновременной инициацией во множестве
точек. Итак, скорость репликации хромосом конт-
ролируется числом и расположением точек начала
репликации. Например, в ранних эмбрионах дрозофилы репликация хромосомы осуществляется
каждые 3 мин благодаря почти одновременной инициации событий в точках, отстоящих друг от друга
на 7000–8000 п.н. В культуре клеток Drosophila
наблюдается значительно более медленная скорость
дупликации хромосомы, поскольку репликация начинается в гораздо меньшем числе точек, находящихся друг от друга на расстоянии 40000 п.н.
Следовательно, при фиксированной скорости роста
цепи множественная инициация обеспечивает большую скорость процесса и уменьшает время, необходимое для дупликации протяженных участков
хромосом.
Структура точек начала репликации. Фрагменты
ДНК, несущие точку начала репликации, выделены
71
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
РНК
oriD
oriR
РИС. 2.5.
В некоторых кольцевых геномах в каждой цепи имеется своя точка начала репликации. Здесь в качестве примера рассмотрена репликация митохондриальной ДНК животных. Синтез одной цепи
начинается в точке oriR. Когда новая цепь
доходит до точки oriD, начинается синтез
другой цепи. Синтез инициируется путем образования праймерной РНК (об
этом подробно говорится в разд. 2.1.ж).
oriR
oriR
ori R
oriD
oriD
Начало репликации
В-цепи ДНК фага fd
fd
РИС. 2.6.
Точки начала репликации одноцепочечных геномов бактериофагов. Промежуточным продуктом репликации у бактериофагов fd, G4 и φХ174 является дуплексная ДНК. Инициация
синтеза геномной ДНК (В-цепь) у всех трех бактериофагов
происходит в единственной точке. Синтез же комплементарной цепи (К-цепь) инициируется в одной (fd и G4) или
нескольких (φХ174) точках.
Начало репликации
К-цепи ДНК фага fd
Начало репликации
В-цепи фага ДНК
φХ174
Начало репликации
В-цепи ДНК фага G4
Начало
репликации
К-цепи ДНК
фага φ Х 1 7 4
Начало репликации
К-цепи ДНК
фага G4
G4
φХ174
72
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 2.7.
Начало репликации (ori)
Репликация линейного дуплексного
генома бактериофага Т7. Синтез
ДНК идет в двух направлениях от
точки ori. Особенности механизма
репликации ДНК таковы, что 5'-концы новосинтезированных цепей остаются незавершенными. Для образования полноценного дуплексного
генома фага необходимы дополнительные шаги (разд. 2.1.з).
Репликация ДНК фага Т7
из Е. coli и некоторых колифагов и плазмид, а также
из дрожжей и ряда эукариотических вирусов. В некоторых случаях место начала репликации имеет
такую нуклеотидную последовательность, что дуплекс принимает необычную конфигурацию, которую распознают белки, участвующие в инициации.
Природа взаимодействия между точкой начала репликации и белками и механизм инициации в целом
исследованы очень мало (разд. 2.1.ж), однако
можно сказать, что, по-видимому, они в разных
случаях различны.
в. Репликация ДНК полуконсервативна
РИС. 2.8.
Репликация линейного дуплексного генома аденовируса человека. Цепи синтезируются последовательно. Копирование матричной цепи начинается каждый раз с
3'-конца.
После начала репликации репликативные вилки
движутся в одном или обоих направлениях вдоль
молекулы ДНК. Чем дальше продвинулась вилка,
тем длиннее новосинтезированный сегмент ДНК.
Прежде чем обсуждать данные о механизмах инициации репликативной вилки и ее движения, полученные с помощью модельных систем репликации
у прокариот (разд. 2.1.ж), рассмотрим основную
реакцию, протекающую в репликативной вилке в
процессе копирования двухцепочечной ДНК.
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
ori
ori
ori
ori
ori
Цепи ДНК синтезируются в результате присоединения 5'-дезоксинуклеотидильных единиц дезоксирибонуклеозидтрифосфатов к 3'-гидроксильному
концу уже имеющейся цепи (праймера) (рис. 2.10).
Следовательно, они синтезируются в направлении
5'–>3' вдоль матричной цепи, ориентированной в
противоположном, 3'–>5', направлении (рис. 2.11).
Синтез цепей в обратном направлении не происходит никогда, поэтому синтезируемые цепи в каждой
репликативной вилке должны расти в противоположных направлениях (рис. 2.12). Синтез одной
цепи (ведущей, лидирующей) происходит непрерывно, а другой (отстающей) – импульсами. Такой механизм репликации называется полунепрерывным. Ве-
ori
73
РИС. 2.9.
Репликация хромосомной ДНК эукариот. Репликация идет в двух направлениях из разных точек начала репликации (ori) с образованием «пузырьков». Как видно из рисунка, по
мере движения репликативных вилок
пузырьки увеличиваются в размере
и в конце концов сливаются. На
электронной микрофотографии видны пузырьки разных размеров в реплицирующейся ДНК Drosophila. (Микрофотография любезно предоставлена D.S. Hogness.)
дущая цепь растет от 5'- к 3'-концу в направлении
движения репликативной вилки и нуждается только
в одном акте инициации. Рост отстающей цепи
также идет от 5'- к 3'-концу, но в направлении,
противоположном движению репликативной вилки.
Для синтеза отстающей цепи должно произойти
несколько актов инициации, в результате чего образуется множество коротких цепей. Эти цепи, называемые фрагментами Оказаки в честь открывшего
их ученого, имеют размеры 1000–2000 нуклеотидов
у прокариот и 100–200 в реплицирующейся ДНК
эукариот. По мере движения репликативной вилки
концы соседних фрагментов Оказаки соединяются
с образованием непрерывной отстающей цепи.
74
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Присоединяемый
дезоксирибонуклеозидтрифосфат
РИС. 2.10.
Цепи ДНК удлиняются путем последовательного присоединения дезоксинуклеотидов к концевой 3'-ОН-группе
каждого предыдущего нуклеотида. Донором новых дезоксинуклеотидных единиц служат 5'-дезоксинуклеозид-
трифосфаты. Присоединение каждого нуклеотида сопровождается высвобождением одной молекулы пирофосфата.
Механизмы инициации репликации в точке начала репликации и при образовании фрагментов Оказаки в отстающей цепи в принципе аналогичны, хотя имеются некоторые тонкие различия
(разд. 2.1.ж). В обоих случаях происходит образование коротких РНК-затравок (праймеров), комплементарных матричной ДНК, в виде продолжения
которых синтезируется новая цепь ДНК (рис. 2.13).
В дальнейшем короткие вставки РНК замещаются
сегментами ДНК, которые затем объединяются с образованием непрерывной отстающей цепи.
г. Комплементарное копирование
оснований,
перенос дезоксинуклеотидов
и лигирование ДНК при репликации
Нуклеотидная последовательность матричной
цепи задает порядок расположения нуклеотидов в
новосинтезируемых цепях ДНК (рис. 2.11). Несмотря на то что правило комплементарности
обеспечивает большую надежность процесса копирования, последний небезошибочен. Из-за случайных флуктуации в структуре присоединяемых
оснований и оснований, входящих в состав матричной цепи, могут происходить ошибочное спаривание
и включение неправильных нуклеотидов (рис. 2.14).
При включении неправильного нуклеотида дальнейший рост цепи обычно останавливается. Ферменты, катализирующие присоединение нуклеоти-
Праймерная цепь
Присоединяемый
дезоксирибонуклеозидтрифосфат
РИС. 2.11.
Репликация ДНК. Рост праймерной
цепи осуществляется путем комплементарного копирования предсуществующей матричной цепи. Условились, что праймерная цепь растет
в направлении 5'–>3', поскольку новые дезоксинуклеотиды присоединяются к 3'-концу. Комплементарная
матричная цепь имеет направление
3'–>5'. Необходимую для протекания
этой реакции энергию система получает за счет гидролиза пирофосфата.
РИС. 2.12.
Синтез обеих цепей ДНК в репликативной вилке идет в направлении
5'–>3', т.е. удлинение цепей происходит в противоположных направлениях. Одна цепь - лидирующая - синтезируется как единое целое, а другая - отстающая - короткими
фрагментами, которые впоследствии соединяются с образованием непрерывной цепи.
Матричная цепь
Праймерная цепь
Матричная цепь
76
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Начало репликации
РИС. 2.13.
Инициация репликации ДНК.
Локальное расплетание
спирали ДНК
Синтез РНК-затравки
Начало синтеза
лидирующей цепи
Синтез РНК-затравок
и начало синтеза
отстающей цепи
Образовавшаяся репликативная вилка
перемещается влево (вверху - лидирующая
цепь, внизу - отстающая)
РИС. 2.14.
Сравнение обычных и необычных, редко встречающихся
пар оснований.
ОБЫЧНЫЕ ПАРЫ
НЕОБЫЧНЫЕ ПАРЫ
А-Т-пара
Дезоксирибоза
А-С-пара
Дезоксирибоза Дезоксирибоза
Тимин
Аденин
Аденин (имино-форма)
G-T-пара
G-C-пара
Дезоксирибоза
Гуанин
Дезоксирибоза
Дезоксирибоза
Цитозин
Дезоксирибоза
Гуанин
Цитозин
Дезоксирибоза
Тимин
(енольная форма)
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
77
РИС. 2.15.
Ошибочное спаривание, происшедшее случайно, приводит к тому, что в цепь ДНК включается неправильный
нуклеотид. При нарушении правильного спаривания оснований между праймерной и матричной цепями рост
цепи останавливается. Синтез может возобновиться,
если ошибочно включенный нуклеотид удалить с помощью соответствующей экзонуклеазы. (Отметим, что
примененное здесь схематическое изображение цепей
ДНК прежде часто встречалось в литературе.)
Праймерная
цепь
Матричная
цепь
3'-5'-Экзонуклеаза
Дальше реакция не идет
дов, обладают эффективной системой коррекции –
они удаляют включенный, но неспаренный нуклеотид почти сразу после присоединения его к концу
растущей цепи (рис. 2.15). В общем виде реакцию
присоединения 5'-дезоксинуклеотидной группы к
3'-ОН-группе концевого нуклеотида праймерной
цепи можно представить следующим образом:
[dNMP]n + dNTP <=> [dNMP]n+1 + PPi
где dNMP – любой из четырех обычных нуклеотидов. За один акт репликации праймерная цепь удлиняется на один остаток, при этом одновременно
происходит удаление пирофосфата. Реакция присоединения нуклеотида обратима, но в целом она
смещена в сторону синтеза, поскольку неорганический фосфат в клетках быстро разрушается. Ферменты, катализирующие праймер-зависимую, де-
терминируемую ДНК-матрицей реакцию присоединения дезоксинуклеотидов, называются ДНК-полимеразами. Многие ДНК-полимеразы выделены и
охарактеризованы, и в разд. 2.1.д детально описаны их свойства и реакции, которые они катализируют.
Фрагменты Оказаки, образующиеся при импульсном копировании цепи ДНК, должны впоследствии объединиться в непрерывную отстающую
цепь (рис. 2.12). Эта реакция осуществляется
ДНК-лигазами – ферментами,
катализирующими
ковалентное сшивание цепей ДНК в дуплексе;
ДНК-лигазы играют ключевую роль не только в
репликации, но и в репарации повреждений (разд. 2.3)
и рекомбинации ДНК (разд. 2.4).
78
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
д. Ключевые ферменты,
участвующие в синтезе ДНК
Многие известные теперь детали процесса репликации ДНК удалось установить благодаря исследованию поведения и активности ферментов,
обеспечивающих
работу
аппарата
репликации.
Наиболее полно изучен механизм репликации бактериальной ДНК, особенно ДНК Е. coli и бактериофагов, которые в ней размножаются. Довольно
хорошо известны и ферменты репликации дрожжей, Drosophila, клеток и вирусов млекопитающих.
Здесь мы обсудим механизм действия ДНК-полимераз и ДНК-лигаз, поскольку при синтезе длинных цепей ДНК эти два фермента работают согласованно.
ДНК-полимеразы. ДНК-полимеразы присутствуют во всех прокариотических и эукариотических
клетках. Более того, многие вирусы бактерий и
животных индуцируют образование вирус-специфических ДНК-полимераз или белков, способствующих эффективному участию ДНК-полимераз
клеток-хозяев в репликации вирусной ДНК. Некоторые прокариотические и эукариотические
ДНК-полимеразы выделены в чистом виде, а их
физические и ферментативные свойства охарактеризованы. И хотя эти свойства не совсем идентичны,
механизм катализа для всех указанных ферментов
в общих чертах одинаков.
Наиболее полно изучена ДНК-полимераза I
(Pol I) E. coli. Она представляет собой одиночный
полипсптид с мультифункциональными активностями. В качестве ДНК-полимеразы Pol I катализирует перенос 5'-дезоксинуклеотидильных единиц
дезоксинуклеозид-5'-трифосфатов к 3'-ОН-группе
в цепи ДНК или РНК, после чего происходит
спаривание перенесенного основания с соответствующим основанием комплементарной цепи ДНК
(разд. 2.1.г и рис. 2.11). Таким образом, для полимеризации ферменту необходимы праймер в качестве дезоксинуклеотидного акцептора и матрица,
детерминирующая присоединение нужного нуклеотида. Помимо полимеризации нуклеотидов, Pol I
катализирует две другие реакции, биологическая
роль которых очень важна (рис. 2.16). В одной из
них происходит гидролиз фосфодиэфирных связей
в одной цепи ДНК или на неспаренном конце
дуплексной ДНК, причем за один акт удаляется
один нуклеотид, начиная с 3'-конца цепи (3'-5'-экзонуклеаза). Вторая реакция также состоит в отщеплении нуклеотидов, но гидролиз начинается с
5'-конца дуплексной ДНК в направлении к 3'-концу
(5'-3'-экзонуклеаза). Эти различные активности
присущи разным сайтам полипептидной цепи Pol I.
Если in vitro обработать Pol I трипсином, то полипептидная цепь расщепится на большой и малый
фрагменты. Большой, С-концевой фрагмент («фрагмент Кленова») сохраняет ДНК-полимеразную и
3'-5'-экзонуклеазную активности; малый, N-концевой фрагмент обладает только 5'-3'-экзонуклеазной
активностью.
Pol I и присущие ей экзонуклеазные активности
играют очень большую роль в репликации и репарации хромосомной ДНК E. coli. 3'-5'-экзонуклеазная активность обеспечивает контроль за присоединением каждого нуклеотида и удаление ошибочных
нуклеотидов с растущего конца цепи (рис. 2.15).
Если эта активность подавлена в результате каких-то мутаций в гене, кодирующем Pol I, то при
репликации генома часто происходят мутации – замены оснований.
Способность ДНК-полимеразы удлинять 3'-конец цепи, спаренной с матричной цепью, позволяет
ей заполнять пробелы между сегментами отстающей цепи. Pol I удлиняет фрагменты Оказаки с
3'-концов и удаляет рибонуклеотиды, с которых
начинаются 5'-концы соседних фрагментов, что
является необходимой предпосылкой для формирования непрерывной отстающей цепи (рис. 2.13).
Поскольку Pol I способна удлинять 3'-конец одной
из цепей в месте разрыва в двухцепочечной ДНК
и удалять нуклеотиды с 5'-конца того же разрыва
(процесс, называемый ник-трансляцией). этот фермент играет ключевую роль в репарации поврежденной ДНК (рис. 2.16 и разд. 2.3). Ник-трансляция
широко используется in vitro для синтеза радиоактивно меченной ДНК (разд. 4.6.б).
У Е. coli имеются и две другие ДНК-полимеразы,
но они присутствуют в клетке в меньших количествах. Pol II присоединяет нуклеотиды значительно
менее эффективно, чем Pol I, и не обладает 5'-3'-экзонуклеазной активностью. Следовательно, Pol II
может заполнять пробелы между фрагментами
ДНК, спаренными с матричной цепью, но не способна отщеплять РНК-нуклеотиды от фрагментов
Оказаки или осуществлять ник-трансляцию. Роль
Pol II в репликации и сохранении хромосомной
ДНК E. coli до настоящего момента неясна.
Pol III-холофермент – это ключевой фермент,
ответственный за репликацию хромосомной ДНК
E. coli. В каждой клетке содержится только 10–20
копий Pol III-холофермента, и тем не менее он
является основным компонентом мультиферментного комплекса, инициирующего формирование
репликативных вилок в точках начала репликации,
участвующего в элонгации лидирующей цепи в
вилке и удлиняющего РНК-праймеры с образованием фрагментов Оказаки. Но поскольку Pol III-xoлофермент не обладает 5'-3'-экзонуклеазной активностью, для репликации отстающей цепи необходимо участие Pol I, чтобы произошло удлинение
продукта, образовавшегося при участии Pol III, и
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
79
3'–>5'-Экзонуклеаза
+
+
5'–>3'-Экзонуклеаза
+
Ник-трансляция
РИС. 2.16.
ДНК-полимераза катализирует 3'–>5'- и 5'–>3'-экзонуклеазные реакции. 3'–>5'-экзонуклеаза расщепляет
одноцепочечную ДНК с 3'-ОН-конца, а 5'–>3'-экзонуклеаза разрушает дуплексную ДНК с 5'-конца. 5'–>3'-экзонуклеазная и полимеразная активности катализируют
процесс, при котором происходят последовательное
отщепление нуклеотидов с 5'-конца одноцепочечного
разрыва в дуплексе и удлинение цепи с 3'-конца. В результате место разрыва перемещается по цепи в направлении от 5'- к 3'-концу (так называемая ник-трансляция). Для осуществления ник-трансляции необходимы дезоксинуклеозидтрифосфаты.
удаление РНК-праймеров на 5'-конце фрагментов
Оказаки.
Обнаружены изменения в полипептидной цепи
основного (кор) фермента Pol III, известны аминокислотные замены, которые позволяют приписать
определенные виды ферментативной активности
конкретным субъединицам ферментного комплекса.
Так, α-субъединица обладает полимеразной активностью,
а ε-субъединица – 3'-5'-экзонуклеазной.
Однако комплекс α- и ε-субъединиц обладает значительно более высокой полимеразной и экзонуклеазной активностями, чем каждая из соответствующих субъединиц в отдельности. Функция третьей, θ-субъединицы пока неясна.
Помимо субъединиц, составляющих Pol III-кор,
Pol III-холофермент содержит еще семь субъединиц:
τ, γ, β, δ, δ', χ и ψ. Перечисленные полипептиды
также существуют во множестве копий, так что
в результате мол. масса комплекса составляет примерно 103 кДа. Роль β-субъединицы заключается
в том, чтобы свести к минимуму вероятность отделения фермента от матрицы до завершения процесса копирования; точная же функция других
субъединиц неизвестна. Вполне возможно, что
Pol III-холофермент существует в двух формах,
каждая из которых содержит определенный набор
вспомогательных субъединиц, придающих ферменту определенные свойства. В одной форме фермент
катализирует синтез непрерывной ведущей цепи,
а в другой – прерывистой отстающей.
Pol III-холофермент катализирует те же реакции
синтеза, что и Pol I, но работает примерно в 60 раз
быстрее. Более того, Pol III-холофермент обладает повышенным сродством к матрице и обеспечивает более высокую эффективность копирования.
Pol III-холофермент может связываться и с другими
белками, увеличивая эффективность процесса копирования благодаря координации некоторых важных
ферментативных этапов репликации. На этом более
высоком уровне организации в комплексы могут
включаться белки, расплетающие спираль ДНК в
точках начала репликации и в репликативных вилках (расплетазы или геликазы), инициирующие образование праймерных РНК (праймазы), обеспечивающие последовательное наращивание цепей ДНК,
терминирующие процесс репликации и разделяющие дочерние спирали ДНК.
ДНК-полимеразы, синтезируемые другими бак-
80
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 2.17.
Все ДНК-лигазы соединяют 5'-фосфорильную и 3'-гидроксильную группы нуклеотидов, находящихся на противоположных концах одноцепочечного разрыва в дуплексе ДНК. Образуется новая фосфодиэфирная связь,
разрыв сшивается.
ДНК-лигазы
териями и многими бактериофагами, различаются
по своим физической структуре и свойствам. Тем не
менее катализируемые ими реакции практически
идентичны реакциям, изученным у Е. coli. У всех
ДНК-полимераз есть корректирующая 3'-5'-экзонуклеаза, однако 5'-3'-экзонуклеаза у некоторых
ферментов отсутствует. Например, ДНК-полимераза фага Т4 может осуществлять 3'-5'-экзонуклеазную реакцию коррекции ошибок, но не способна
катализировать 5'-3'-экзонуклеазную реакцию и
поэтому не может обеспечить ник-трансляцию. При
репликации ДНК фага Т4 5'-3'-экзонуклеазную
реакцию удаления РНК-праймеров перед объединением фрагментов Оказаки катализирует другой
кодируемый фагом белок. В процессе прерывистого
синтеза отстающих цепей и репарации повреждений
ДНК фага Т4 этот фермент работает согласованно
с фаговой ДНК-полимеразой.
В эукариотических клетках идентифицировано
множество ДНК-полимераз, но их физические и
функциональные свойства изучены менее детально,
чем у соответствующих ферментов прокариот. Из
клеток млекопитающих выделены четыре ДНК-полимеразы: α, β и δ содержатся в ядрах, а γ – в митохондриях. ДНК-полимераза а участвует в репликации хромосомной ДНК. Ее полимеразная активность связана с большим полипептидом, но она
существует и, возможно, функционирует как мультисубъединичный белок, аналогично Pol III-холоферменту E. coli. β-Полимераза – это одиночный
полипептид, функцией которого является заполнение пробелов при репарации повреждений ДНК.
Митохондриальная полимераза γ, состоящая из
четырех идентичных полипептидов, ответственна за
репликацию митохондриального генома. δ-Полимераза похожа на полимеразу α по своим молекулярным и синтетическим свойствам и также участвует в репликации хромосомной ДНК. Поскольку
α-, β- и γ-ДНК-полимеразы млекопитающих лишены 3'-5'- и 5'-3'-экзонуклеазных активностей,
присущих ферментам Е. coli, остается неясно, как
в процессе репликации ДНК у этих организмов
удаляются случайно включенные ошибочные нуклеотиды и РНК-затравки на концах фрагментов
Оказаки.
Некоторые вирусы животных (например, гер-
песвирус, вирус коровьей оспы и вирус гепатита)
индуцируют синтез особых полимераз для репликации своих геномов. Другие вирусы образуют
белки, которые стимулируют системы репликации
клеточной ДНК или участвуют в репликации вирусной ДНК. Например, паповавирусы синтезируют
белки, необходимые для инициации репликации.
Аденовирусы человека кодируют белки, «запускающие» инициацию синтеза обеих цепей линейной
вирусной ДНК (разд. 2.1.ж). Они продуцируют также особые ДНК-связывающие белки, облегчающие
репликацию.
ДНК-лигазы. ДНК-лигазы необходимы для
соединения цепей ДНК при репликации, репарации
и рекомбинации. Все известные лигазы способны
образовывать фосфодиэфрные мостики между
5'-фосфорильной и 3'-гидроксильной группами соседних дезоксинуклеотидов в местах разрывов ДНК
(рис. 2.17). ДНК-лигаза, индуцируемая в E. coli после заражения клетки фагом Т4 (Т4-лигаза), уникальна по своей способности соединять двухцепочечные
фрагменты ДНК по концам разрыва (рис. 2.18).
Физиологическая роль этой реакции неизвестна, но
практическое ее значение в манипуляциях с рекомбинантной ДНК неоценимо (разд. 4.5 и 6.2).
ДНК-лигазы некоторых бактерий (E. coli и
B. subtilis), бактериофагов (Т4 и Т7) и млекопитающих выделены и их структура и механизм каталитической активности установлены. ДНК-лигазы
Е. coli, T4 и Т7 – это одиночные полипептидные цепи,
Т4-лигаза
РИС. 2.18.
ДНК-лигаза, кодируемая ДНК фага Т4, соединяет два
фрагмента дуплексной ДНК конец в конец. В каждой из
цепей образуется новая фосфодиэфирная связь.
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
РИС. 2.19.
Никотинамидадениндинуклеотид (NAD).
а структура двух видов ДНК-лигаз млекопитающих
неизвестна. Для образования фосфодиэфирных связей между соответствующими концами нуклеотидных цепей лигазы используют энергию гидролиза
81
либо АТР, либо его производного – никотинамидадениндинуклеотида (NAD) (рис. 2.19). Реакция
протекает в несколько этапов (рис. 2.20): 1) аденилильная единица NAD (лигазы Е. coli и В. subtilis)
или АТР (лигазы фагов Т4, Т7 и млекопитающих)
переносится на ε-аминогруппу лизинового остатка
лигазы с одновременным высвобождением никотинамидмононуклеотида или неорганического фосфата соответственно; 2) аденилильная группа переносится от белка на 5'-фосфорильную группу концевого остатка цепи ДНК с образованием пирофосфорильного
производного,
аденилил-ДНК;
3) аденилильная группа, связанная с 5'-фосфорильной руппой, замещается 3'-гидроксильной группой
прилегающего конца ДНК. В результате этих
реакций происходит образование фосфодиэфирных
связей в цепи ДНК за счет энергии гидролиза
пирофосфорильной связи NAD или АТР. Для образования фосфодиэфирной связи во всех случаях,
кроме лигазы фага Т4, должно произойти соединение нуклеотида, содержащего акцепторную 3'-гидроксильную группу, с соседним нуклеотидом, несущим активированную 5'-фосфорильную группу.
ДНК-лигазы Е. coli и фага Т4 могут соединять
(1)
Аденилирование
(2)
Трансаденилирование
(3)
Лигирование
РИС. 2.20.
Механизм действия ДНК-лигазы (Enz). Сокращения:
Lys - лизин, входящий в состав лигазы, Rib - рибоза,
Ad - аденин, Nic - никотинамид, NMN - никотинамидмононуклеотид, РРi- пирофосфат.
82
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ
концы двух разных дуплексных фрагментов или
разорванные концы цепей линейной или кольцевой
ДНК. Таким образом, с помощью ДНК-лигаз могут образовываться и линейные, и кольцевые дуплексные молекулы ДНК.
е. Для репликации
необходимо раскручивание спирали
Для осуществления комплементарного копирования цепей двухцепочечная ДНК должна постепенно раскручиваться. Раскручивание, или расплетание,
спирали происходит только в локальном участке
репликативной вилки. Расплетание – это не спонтанный процесс, в нем участвуют белки двух типов
(рис. 2.21). Одни из них, называемые ДНК-геликазами, используют для разделения цепей энергию,
высвобождающуюся при гидролизе АТР до ADP.
Геликазы часто функционируют в составе комплекса, осуществляющего перемещение репликативной вилки и репликацию расплетенных цепей
(разд. 2.1). Вообще говоря, для расплетания достаточно одного геликазного белка, но для того, чтобы
максимизировать скорость раскручивания, несколько геликаз могут действовать совместно. Белки
второго типа, дестабилизирующие спираль,– это
белки, связывающиеся с одноцепочечными участками
и тем самым стабилизирующие расплетенный дуплекс. Итак, геликазы вызывают локальное раскручивание двойной спирали, а другие специфические
белки тотчас связываются с образовавшимися одноцепочечными участками, обеспечивая условия для
комплементарного спаривания.
При репликации хроматиновой ДНК (разд. 1.2.ж)
эукариотических организмов возникают допол-
ДНК-геликаза
Белки , связывающиеся с
одноцепочечной ДНК
Матрица
для синтеза
лидирующей
цепи
НАСЛЕДСТВЕННОСТИ: ОБЗОР
нительные сложности. Чтобы расплести ДНК в
составе хроматина, необходимо разрушить сильно
конденсированный комплекс гистонов и ДНК, а по
завершении репликации вновь упаковать две дочерние спирали в сложные хроматиновые структуры. Каким образом раскручиваются эукариотические хромосомы при подготовке к репликации? Об
этом известно очень мало. Развернутые, предсуществующие и новые нуклеосомы (собранные из
новосинтезированных гистонов) должны ассоциировать с синтезированной дуплексной ДНК. Чтобы
предотвратить образование слишком протяженных
участков несвязанной ДНК в период репликации,
сборка хроматина должна происходить параллельно образованию дуплексной ДНК. Связываются ли
родительские гистоновые октамеры с одной или
обеими дочерними спиралями – пока неизвестно.
Топологические проблемы раскручивания и репликации ДНК. Процесс раскручивания двойной спирали в репликативной вилке порождает механические и топологические проблемы. В принципе расплетание линейной дуплексной ДНК может происходить благодаря вращению родительской спирали
вокруг собственной оси (рис. 2.22). Однако вращение очень длинных цепей ДНК вокруг длинных же
осей во внутриклеточном пространстве механически
затруднено. При репликации замкнутых кольцевых
ДНК расплетание цепей в вилке создает дополнительные проблемы. По мере раскручивания цепей
степень отрицательной сверхспиральности сегментов, находящихся перед вилкой репликации, постепенно уменьшается и в них возникает положительная сверхспирализация. Дальнейшее перемещение
вилки вдоль кольца затрудняется и в конце концов
блокируется. Это блокирование снимается путем
внесения одноцепочечного разрыва. Тем самым
образуется «шарнир», который дает возможность
нереплицированному дуплексу, находящемуся перед
вилкой, вращаться вместе с ней (рис. 2.23). Такие
разрывы вносятся в ДНК с помощью ферментов,
имеющих общее название ДНК-топоизомеразы.
ДНК-топоизомеразы. Эти ферменты изменяют
степень сверхспиральности и тип сверхспирали. Они
не только приводят к образованию шарнира, который создает условия для непрерывного движения
репликативной вилки, но и обеспечивают разделение или образование катенанов – сцепленных кольМатрица
для синтеза
отстающей
РИС. 2.21.
Расплетание дуплексов ДНК облегчается в присутствии двух белков: геликазы
и белка, связывающегося с одноцепочечной ДНК.
83
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
Здесь должно
происходить
быстрое вращение
спирали ДНК
занной цепи. Одиночная цепь спонтанно проходит
через разрез. Отмечены два интересных, но, возможно, не связанных друг с другом различия между
топоизомеразами типа I про- и эукариот: 1) топоизомеразы типа I прокариот взаимодействуют с
5'-фосфорильным концом разорванной цепи, а эукариот – с 3'-фосфорильным концом; 2) топоизо-
Типичная дуплексная структура
Матрица для синтеза
лидирующей цепи
Матрица для синтеза
отстающей цепи
Более плотно скрученный дуплекс
ДНК-полимераза
Сверхспиральный
дуплекс
Синтезируемая цепь ДНК
Разрыв
РИС. 2.22.
Вращение двойной спирали ДНК может снять механическое напряжение, возникающее при раскручивании
двух цепей в репликативной вилке. [В. Alberts et al.,
Molecular Biology of the Cell (New York: Garland, 1983), p.
228.]
цевых ДНК, а также устранение узлов и спутанных
клубков из длинной линейной ДНК. Топоизомеразы
являются также неотъемлемыми участниками некоторых рекомбинационных процессов (разд. 2,4).
В различных организмах идентифицированы
топоизомеразы двух основных типов. Одни ферменты, называемые топоизомеразами типа I, уменьшают число сверхвитков в ДНК на единицу за один
акт. Эти топоизомеразы надрезают одну из двух
цепей, в результате чего фланкирующие дуплексные
области могут повернуться вокруг интактной цепи,
и затем воссоединяют концы разрезанной цепи
(рис. 2.24). Эта реакция не требует энергии АТР,
поскольку энергия фосфодиэфирной связи сохраняется благодаря тому, что тирозиновый остаток
в молекуле фермента выступает то в роли акцептора, то в роли донора фосфорильного конца разре-
Восстановление нормальной
дуплексной структуры
нереплицированного участка
Репликация может продолжаться
РИС. 2.23.
Снятие механического и топологического напряжений
в замкнутом кольцевом дуплексе перед репликативной
вилкой. При внесении разрыва нереплицированная
сверхспиральная часть ДНК может вращаться вместе
с репликативной вилкой. Напряжение, возникающее в
длинных цепях ДНК во время репликации in vivo, снимается именно таким способом.
84
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
ДНК-топоизомераза
разрезает одну из цепей
и коваяентно связывается
с фосфатной группой
молекулы ДНК
ходящим через место разрыва, оказывается другая
замкнутая молекула ДНК; это приводит к разделению сцепленных кольцевых ДНК или, напротив,
к образованию таких сцепленных комплексов
(катенанов). Этот механизм может использоваться
и для распутывания или запутывания клубков, а
также для раскручивания или конденсации крупных
дуплексных ДНК.
Топоизомеразы типов I и II снимают сверхвитки,
образующиеся при репликации кольцевой ДНК.
Дуплекс может
вращаться вокруг
фосфодиэфирной связи
Фосфодиэфирная связь
восстанавливается
РИС. 2.24.
Реакции, катализируемые топоизомерами типа I.
меразы прокариот устраняют только отрицательные сверхвитки, а эукариотические – как отрицательные, так и положительные.
Топоизомеразы типа II устраняют как отрицательные, так и положительные сверхвитки. В отличие от ферментов типа I топоизомеразы типа II
вносят временные разрывы в обе комплементарные
цепи, пропускают двухцепочечный сегмент той же
самой или другой молекулы ДНК через разрыв,
а затем соединяют разорванные концы (рис. 2.25).
Топоизомеразы типа II тоже используют тирозиновые остатки (присутствующие по одному в каждой из субъединиц ферментов) для связывания 5'конца каждой разорванной цепи в то время, когда
другой дуплекс проходит через место разрыва. В результате внесения двухцепочечного разрыва и прохождения через него другого дуплекса за один акт
снимаются два отрицательных или положительных
сверхвитка. В некоторых случаях дуплексом, про-
РИС. 2.25.
Топоизомеразы типа II катализируют размыкание двух
кольцевых дуплексов. [В. Alberts et al., Molecular Biology
of the Cell (New York: Garland, 1983), p. 229.]
85
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
Однако существует особая топоизомераза II, называемая гиразой и обнаруженная пока только у бактерий, которая индуцирует образование отрицательных сверхвитков в релаксированных кольцевых
ДНК. Для этого гираза делает двухцепочечные
надрезы и затем особым способом воссоединяет
концы (рис. 2.26, А). Итак, гираза снимает положительные сверхвитки и вносит отрицательные в релаксированную ДНК. Сбалансированное действие
топоизомеразы I и гиразы – по крайней мере у бактерий – по-видимому, регулирует степень сверхспиральности ДНК и таким образом влияет на скорость движения репликативной вилки. Механизм,
с помощью которого гираза катализирует образование отрицательных сверхвитков в кольцевой
или другой ДНК с топологическими ограничениями, до конца не установлен. Гираза Е. coli представляет собой тетрамер, состоящий из субъединиц
двух типов (α2β2), при этом α-субъединицы содержат сайты ковалентного связывания концов молекулы ДНК. Гираза катализирует образование отрицательных сверхвитков, создавая сначала положительные сверхвитки в определенных областях ДНК,
связанных с ферментом (рис. 2.26, Б). Ориентация
двух спиральных сегментов в этих областях меняется на противоположную при протягивании одного сегмента через «ворота», образовавшиеся в
результате двухцепочечного разрыва в другом. В
конце концов образуются два сверхвитка за один
каталитический цикл. Для реализации всех этих
Восстановление
взаимодействия
с ферментом
Разрыв ДНК
Образование структуры с
положительным сверхвитком
Частичное
освобождение
ДНК
Надрезание дальнего дуплекса
Б
Протягивание
ДНК
через разрыв
Воссоединение
разорванной ДНК
Воссоединение дуплекса спереди
РИС. 2.26.
А
В бактериях обнаружена топоизомераза типа II, называемая ДНК-гиразой. А. Схематическое представление
образования отрицательных сверхвитков (—) в релаксированном кольцевом дуплексе ДНК под действием гиразы. Б. Детальное изображение процесса. [A. Morrison,
N.R. Cozzarelli, Proc. Natl. Acad. Sci. USA, 78 (1981),
1416-1420.]
86
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
процессов необходима энергия гидролиза АТР, поскольку релаксированная кольцевая ДНК должна
быть переведена на более высокий энергетический
уровень, характерный для сверхспиральной конформации.
ж. Инициация образования
новых цепей ДНК и их рост
в репликативных вилках
Инициация образования новых цепей ДНК. В отличие от РНК, синтез которой инициируется
РНК-репликазами (разд. 2.5) и РНК-полимеразами
(часть III), для инициации синтеза ДНК требуется
затравка (праймер). Сначала синтезируются короткие РНК-праймеры, которые затем наращиваются
в виде цепей ДНК. При переводе кольцевой одноцепочечной ДНК фага М13 в двухцепочечную репликативную форму для синтеза коротких сегментов
РНК в точке начала репликации используется РНКполимераза-холофермент (рис. 2.27). При репликации других одноцепочечных кольцевых фаговых
ДНК (G4) РНК-праймер синтезируется специальной
РНК-полимеразой, называемой праймазой. У другого фага с одноцепочечной кольцевой ДНК (φХ174)
мультиферментный комплекс, содержащий от 15 до
20 полипептидных цепей (праймосома), активирует
матричную цепь, в результате чего праймаза синтезирует РНК-затравку. Праймосомо-праймазный
способ инициации применяется и для инициации
синтеза ведущей цепи в точке начала репликации
у Е. coli, а также при образовании фрагментов Оказаки при синтезе отстающей цепи.
По-видимому, синтез цепей ДНК инициируется
сходным образом (с незначительными вариациями)
у про- и эукариот, в случае плазмид и вирусов.
Различия могут касаться типов полимераз, синтезирующих РНК-затравки, вспомогательных белков, обеспечивающих инициацию РНК-транскриптов, и либо нуклеотидных последовательностей
per se, либо структурных особенностей, определяющих положение точки начала транскрипции.
Длина РНК-праймеров варьирует в зависимости от
особенностей инициации. У бактериофага φХ174 и
Е. coli праймаза катализирует синтез РНК-праймеров длиной от двух до пяти нуклеотидов, а при
РИС. 2.27.
Инициация репликации одноцепочечной фаговой ДНК.
Для синтеза праймерной РНК в точке начала репликации разные фаги используют различные ферменты.
(SSB-белок, связывающийся с одноцепочечной молекулой.)
φХ174
G4
М13
SSB
SSB
SSB
G4
φX174
Праймосома
M13
Праймаза
РНК-полимераза
Праймер
φX174
G4
Праймер
M13
Праймер
87
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
репликации ДНК эукариот праймерные РНК приблизительно в два раза длиннее. У бактериофагов
М13 и G4 синтез РНК-затравок катализируют
РНК-полимераза и G4-праймаза соответственно;
длина этих затравок колеблется от 20 до 30 нуклеотидов, и они комплементарны сегментам фаговых ДНК, образующим петли (рис. 2.27). Точная
природа сигналов, определяющих сайты синтеза
праймерной РНК для инициации репликации или
для синтеза отстающей цепи, неизвестна.
Репликация плазмидной ДНК Col E1 также начинается с транскрипции РНК (в гл. 5 описано
использование таких плазмид в качестве векторов
для клонирования). Однако в этом случае синтез
праймерной РНК инициируется РНК-полимеразой
в сайте, отстоящем на 555 пар оснований от точки
начала репликации плазмидной ДНК (рис. 2.28).
Транскрипция проходит точку начала репликации,
при этом синтезируется цепь РНК длиной 500–600
нуклеотидов. Затем РНКаза-Н расщепляет большую часть цепи РНК. Остающийся 3'-конец РНК
служит затравкой при синтезе цепи ДНК с помощью Pol I-полимеразы. Эта цепь становится ведущей при репликации всей плазмидной ДНК.
У аденовирусов человека синтез новых цепей
ДНК инициируется неким белком, а не РНК
(рис. 2.29). Аденовирус типа 2 содержит белок с
мол. массой 55 кДа, ковалентно связанный с 5'-фосфатом каждой цепи ДНК. Первый этап инициации
синтеза новых цепей состоит в том, что кодируемый
вирусом белок мол. массой 80 кДа связывается
с дезоксинуклеозидтрифосфатом, соответствующим
первому дезоксинуклеотидному остатку в ДНК
(dCTP), с образованием комплекса белок-dCMP.
3'-гидроксильная группа связанного с белком дезоксицитидинового остатка служит праймером для
удлинения цепей ДНК с использованием комплементарной цепи ДНК в качестве матрицы. В конечном счете вирусный 80 кДа-белок отщепляется
и с новосинтезированной вирусной ДНК остается
связанным только терминальный белок мол. массой
55 кДа. Аналогичный механизм инициации синтеза
ДНК используется и другими аденовирусами и некоторыми бактериофагами.
Одновременная репликация обеих цепей в репликативной вилке. Изучение механизма репликации фаговой ДНК с использованием очищенных ферментов из Е. coli позволило построить усовершенствованную модель полуконсервативной прерывистой
репликации ДНК в репликативной вилке (рис. 2.30).
Для расплетания спирали при образовании вилки
необходимо, чтобы в ДНК образовались отрицательные сверхвитки (разд. 2.1.е). Расплетание осуществляется АТР-зависимой геликазой и облегчается в присутствии белка, связывающегося с одноцепочечной ДНК. После инициации репликации
Pol III-холофермент удлиняет лидирующую цепь
ДНК до размеров, равных длине хромосомы, путем
последовательного присоединения к 3'-гидроксильному концу дезоксинуклеотидильных единиц.
Синтез отстающей цепи инициируется праймосомо-праймазным комплексом (рис. 2.31). Праймосома, обладающая геликазной активностью, расплетает спираль и, возможно, способствует формированию подходящих структур, позволяющих ассоциированной праймазе синтезировать праймер. ПрайСинтез праймера
Промотор
Праймер
Инициация
–555
Элонгация
Расщепление
с помощью
РНКазы Н
Присоединение
dNMP
с помощью
ДНК-полимеразы I
Элонгация
ДНК,
удаление
праймера и
лигирование
РИС. 2.28.
Инициация репликации плазмид типа Col E1.
1
ori
88
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
мосомо-праймазный комплекс движется в том же
направлении, что и вилка, останавливаясь только
для того, чтобы расплести дуплекс и синтезировать
РНК-праймеры. Эти короткие фрагменты РНК доИиициаторный
dCTP
Праймер
страиваются затем Pol III-холоферментом путем добелок (80 кДа)
бавления дезоксинуклеотидтрифосфатов с образованием фрагментов Оказаки длиной от 1000 до 2000
нуклеотидов (рис. 2.30). Удаление сегментов РНК
с 5'-конца каждого фрагмента Оказаки и заполнение
пробелов между ними катализируется Pol I, способБелок, связанный с 5'-концом
ной удлинять цепи и осуществлять ник-трансляцию.
вирусного генома (55 кДа)
Когда растущий 3'-гидроксильный конец каждого
фрагмента Оказаки доходит до 5'-дезоксинуклеотидного конца соседнего фрагмента, вступает в действие ДНК-лигаза и образуется непрерывная отстающая цепь. Более сложная, но все же гипотетическая модель (рис. 2.32) движения репликативной
вилки предполагает формирование реплисомы –
РИС. 2.29.
Инициация репликации ДНК аденовируса. Ключевым мультиферментного комплекса более высокого уровмоментом является связывание инициаторного белка ня организации, состоящего из функциональномол. массой 80 кДа с dCTP и закрепление этого комп- го праймосомо-праймазного комплекса, геликазы,
лекса на 3'-конце матричной цепи.
Pol III-холофермента и, возможно, гиразы. Такой
комплекс может обеспечивать удлинение лидирующей цепи и одновременно инициацию праймерной
РНК, а также достраивание ДНК при синтезе отстающей цепи. Две реплисомы, работающие согласоГеликазная субъединица
ванно в двух вилках репликации, которые движутся
Праймосома
в противоположных направлениях вдоль кольцевой
Праймаза
хромосомы, сделали бы эту модель еще более изящной.
РНК
ДНК, удлиняемая Pol III
РНК-затравка
ДНК, удлиняемая
ДНК, удлиняемая
РНК, которая должна
быть удалена Pol I
Разрыв, который
должен быть
зашит лигазой
Pol I
Pol III
РИС. 2.30.
ДНК, удлиняемая Pol I
Отстающая цепь
Лидирующая цепь
Геликаза
Полуконсервативный механизм репликации ДНК Е.соli.
Праймосома
РНК-затравка
Праймаза
Матрица для синтеза
лидирующей цепи
РИС. 2.31.
Матрица для синтеза
отстающей цепи
Инициация синтеза отстающей цепи. [Из
работы A. Kornberg, DNA Replication, Supplement (San Francisco: W.H. Freeman, 1982),
p. S113, с изменениями.]
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
Репликация по типу катящегося кольца. Некоторые двухцепочечные кольцевые хромосомы реплицируются альтернативным способом, называемым
репликацией по типу катящегося кольца (рис. 2.33).
В этом случае двухцепочечная кольцевая ДНК надрезается специфическим ферментом в уникальном
сайте одной цепи (точке начала катящегося кольца),
и к образовавшемуся в результате надреза 3'-гидроксильному концу с помощью Pol III-холофермента
89
присоединяются нуклеотиды; при этом матрицей
служит интактная замкнутая цепь. Таким образом,
в вилке синтезируется только лидирующая цепь. По
мере синтеза лидирующей цепи происходит вытеснение 5'-конца надрезанного кольца как одиночной
цепи. В результате длина лидирующей цепи может
превышать длину матрицы в два-пять раз.
У фагов М13 или φХ174, чьи зрелые геномы
представлены одноцепочечными кольцевыми ДНК,
Этап I
Этап I I
Реплисома
Этап IV
Этап III
Полимераза I
+ лигаза
РИС. 2.32.
Лидирующая
цепь
Отстающая
цепь
Синтез обеих цепей ДНК в репликативной вилке с участием мультиферментного комплекса - реплисомы. [Из работы A. Kornberg,
DNA Replication, Supplement (San
Francisco: W.H. Freeman, 1982), p.
S125.]
90
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Внесение
одноцепочечного
разрыва
Вирус
с одноцепочечным
геномом (М13)
Вирус с двухцепочечным
геномом (λ)
РИС. 2.33.
Репликация по типу катящегося кольца (см. текст).
такой способ репликации используется на поздних
стадиях инфекционного процесса, после того как
инфицирующая ДНК превращается в двухцепочечную кольцевую форму. Постоянно отделяющиеся
одиночные цепи ДНК, образуемые при репликации
по типу катящегося кольца, надрезаются в каждой
точке начала репликации и замыкаются с образованием зрелых форм, упаковываемых в вирусные частицы.
Фаг λ использует такой способ репликации при
образовании двухцепочечной линейной вирусной
ДНК (рис. 2.33). Субстратной матрицей в этом случае является двухцепочечная кольцевая ДНК, которая была реплицирована после превращения на
ранних этапах инфекции линейной вирусной ДНК
в кольцевую репликативную форму. Для того чтобы
образовалась линейная ДНК потомства, двухцепочечные кольца надрезаются и асимметрично реплицируются, как это происходит в случае ДНК фагов
М13 и φХ174. Однако отделяющиеся одиночные
цепи превращаются в двухцепочечные структуры.
Сначала во множестве сайтов вдоль одиночной цепи
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
праймаза синтезирует короткие сегменты РНК. Затем эти сегменты достраиваются Pol III-холоферментом, пробелы заполняются, РНК удаляется с помощью Pol I и наконец короткие фрагменты ДНК
соединяются ДНК-лигазой. При упаковке ДНК в
фаговые частицы в специальных участках, называемых cos-сайтами и отстоящих друг от друга на
длину вирусного генома, образуются надрезы. В результате длинные дуплексы многократно повторенной ДНК фага λ расчленяются на фрагменты, соответствующие по размерам зрелой ДНК, обнаруживаемой в вирионах.
Концевой
вирусный
белок
91
Поочередная репликация цепей. Репликация ДНК
аденовируса происходит без синтеза отстающей цепи и поэтому без образования множественных сайтов инициации и фрагментов Оказаки (рис. 2.34).
Вместо этого цепи линейного дуплексного генома
реплицируются попеременно. Сначала через образование белкового праймера происходит инициация
одной цепи, которая непрерывно удлиняется вплоть
до завершения репликации. Вытесненная новосинтезированной цепью, вторая цепь дуплекса служит
матрицей при синтезе таким же способом следующего дуплекса. С какого конца родительского дуп-
Зрелая ДНК аденовируса
Концевой
вирусный
белок
А
Инициаторный
вирусный
белок
РИС. 2.34.
Б
Поочередная репликация цепей ДНК аденовируса. А.
Двухцепочечная ДНК аденовируса, у которой с каждым
5'-концевым остатком цитозина связан белок мол. массой 55 кДа. Б. Синтез цепей ДНК последовательно
инициируется с конца каждой исходной цепи с помощью
комплекса «белок с мол. массой 80 кДа - dCTP». К моменту завершения синтеза цепи этот белок расщепляется, и часть его с мол. массой 55 кДа остается связанной
с 5'-концом цепи.
92
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
лекса начнется процесс, по-видимому, неважно. Репликация ДНК аденовируса необычна в двух отношениях: 1) использование белка для запуска синтеза
цепи ДНК с конца линейного дуплекса; 2) отсутствие прерывистой репликации, опосредуемой РНКтранскриптами.
Новосинтезированная
цепь
с РНК-затравкой
з. Терминация репликации ДНК
и расхождение дочерних спиралей
Терминация и расхождение в кольцевых геномах.
Замкнутость структуры многих геномных ДНК упрощает завершение репликации всей нуклеотидной
последовательности. Непрерывный рост лидирующей и отстающей цепей вдоль кольцевой матрицы
неизбежно приводит к совмещению 3'-гидрокси- и
5'-фосфорильного концов одной цепи либо в точке
начала репликации, либо – при двунаправленной
репликации – в середине кольца (рис. 2.35). Кольца
в этих местах встречи соединяются ДНК-лигазой,
при этом обычно они оказываются попарно сцеп-
Топоизомераза
типа II
РИС. 2.35.
Репликация замкнутой кольцевой дуплексной ДНК и
расхождение двух дочерних кольцевых молекул.
Удаление
РНК-затравки
РИС. 2.36.
При удалении РНК-затравки с 5'-конца новосинтезированной цепи ДНК на одном конце дуплекса остается
пробел.
ленными, и в дальнейшем должно произойти их
разъединение на отдельные геномы. Это происходит
с помощью топоизомеразы типа II (рис. 2.25).
Терминация и завершение репликации в линейных
ДНК. За исключением репликации аденовирусной
ДНК (рис. 2.34), где синтез новых цепей ДНК инициируется белковым праймером и матричная цепь
копируется полностью, во всех других случаях для
репликации необходим РНК-праймер, что создает
особые проблемы при завершении репликации линейной дуплексной ДНК (рис. 2.36). Дело в том, что
после инициации синтеза новой цепи и последующего удаления РНК-праймера новосинтезированная
цепь содержит пробел на 5'-конце. Поскольку никаких способов удлинения 5'-концов цепей ДНК не
существует, необходимы какие-то иные методы завершения репликации.
Были предложены два способа, с помощью которых процесс репликации мог бы завершаться. Один
из них предполагает, что существуют цепи ДНК
с прямыми повторами на концах (рис. 2.37). После
репликации два комплементарных конца обоих незавершенных дуплексов могут спариться и образовать линейные конкатемеры с одноцепочечными
разрывами. Остающиеся пробелы могут быть заполнены путем удлинения цепей в направлении
3'–>5' с последующим соединением их ДНК-лигазой либо путем прямого соединения стыкующихся
концов с помощью ДНК-лигазы с образованием
конкатемеров. После надрезания конкатемера специфической эндонуклеазой образуются выступающие 5'-концы, и ДНК-полимераза может наращивать более короткие цепи с 3'-конца. Другой способ
предполагает наличие на конце каждой цепи ДНК
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
93
Репликация
Спаривание концов
Лигирование
Специфическая эндонуклеаза
вносит разрыв
Достраивание
концов
РИС. 2.37.
Предполагаемая модель завершения репликации линейной двухцепочечной ДНК. [По данным работы
J.D. Watson, Nature, New Biology, 239 (1972), p. 197.]
коротких инвертированных повторов, благодаря которым образуются небольшие петли (рис. 2.38). 3'конец петли служит праймером для копирования
нереплицированного участка. Благодаря специфическому разрыву в начале инвертированного повтора
получается структура, которую можно достроить
с 3'-конца до восстановления исходной двухцепочечной концевой последовательности.
Недавно полученные данные свидетельствуют
о том, что концевые области эукариотических хромосом – теломеры – реплицируются с помощью особого механизма, отличного от представленных выше. Концы хромосом дрожжей, беспозвоночных,
растений и позвоночных имеют сходное, весьма
необычное строение (разд. 9.6.б): они содержат
шпилькообразные структуры, в которых 3'- и 5'-кон-
Достраивание
концов
цы дуплекса ДНК оказываются рядом, и много
коротких тандемных повторов. Около петли в одной из цепей в области повторов имеются множественные одноцепочечные разрывы. Вопрос о том, как
подобная структурная организация может способствовать репликации концов дуплексных участков,
выясняется. Если учесть сходство структурных особенностей конечных областей хромосом, то можно
предположить, что механизм репликации всех эукариотических хромосом одинаков (разд. 9.6.б).
2.2. РЕПЛИКАЦИЯ РНК
С ОБРАЗОВАНИЕМ ДНК
а. Репликация геномов ретровирусов
Геном ретровирусов представлен единственной
молекулой одноцепочечной РНК. После проникновения РНК в клетку хозяина вирусный геном подвергается обратной транскрипции, при этом сначала
94
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Спаривание
палиндромных
участков
Лигаза
Полимераза
Палиндромспецифическая
эндонуклеаза
Полимераза
РИС. 2.38.
Другая предполагаемая модель завершения репликации
линейной двухцепочечной ДНК. [Т. Cavalier-Smith, Nature, 250 (1974), p. 467.]
образуется дуплекс РНК-ДНК, а затем двухцепочечная ДНК. Эти этапы предшествуют экспрессии
вирусных генов на уровне белков и образованию
РНК-геномов.
Фермент, катализирующий комплементарное копирование РНК с образованием ДНК, называется
обратной транскриптазой. Он содержится в ретровирусных частицах (вирионах) и активируется после
попадания вируса в клетку и разрушения его липидно-гликопротеиновой оболочки. Вполне вероятно,
что обратной транскрипции способствуют какие-то
вспомогательные белки, находящиеся внутри вирионов, поскольку в присутствии последних ферментативная реакция протекает гораздо эффективнее и
быстрее, чем в присутствии очищенного фермента.
Появляется все больше данных о том, что обратная
транскрипция происходит в самых разных эукариотических клетках, а обратная транскриптаза играет важную роль в процессах перестройки генома
(разд. 10.3 и 10.4).
Обратные транскриптазы ретровирусов по существу являются ДНК-полимеразами, и in vitro могут
использовать в качестве матрицы ДНК. Однако
гораздо эффективнее они работают, если матрицей
является РНК. Как и все ДНК-полимеразы, обратные транскриптазы не способны инициировать синтез новых цепей ДНК. Но если синтез уже иниции-
рован с помощью праймерной РНК или 3'-концевого участка ДНК, то фермент эффективно осуществляет синтез, используя цепь ДНК как матрицу.
Ретровирусы – это диплоидные организмы, поскольку каждый вирион содержит две идентичные
цепи РНК размером от 8000 до 10000 нуклеотидов.
Цепи соединены вблизи своих 5'-концов, однако
природа этого нековалентного взаимодействия неизвестна. Области 5'- и 3'-концов обеих цепей модифицированы, как и у всех эукариотических мРНК
(5'-кэпы и 3'-полиадениловые хвосты; разд. 3.8.а)
(рис. 2.39). Рассматривая механизм обратной транскрипции, необходимо отметить наличие пяти структурных элементов у вирусной РНК: 1) прямые повторы на 5'- и 3'-концах РНК (R); 2) последовательность из 80–120 нуклеотидов, соседствующая с 5'концевым повтором (U5); 3) последовательность из
170–1200 нуклеотидов, соседствующая с 3'-концевым повтором (U3); 4) последовательность из 15–20
нуклеотидов (Р), в пределах которой клеточная
тРНК спаривается с ретровирусной РНК, что создает праймер для синтеза первой цепи ДНК; 5) сегмент Рu, находящийся непосредственно перед повтором U3 и являющийся сайтом для праймирования второй цепи ДНК; такой сегмент одинаков
у РНК всех ретровирусов определенного типа (т.е.
его последовательность практически идентична у
всех вирусов птиц и отличается от подобной последовательности у вирусов мышей).
Известны три продукта, образующиеся в результате обратной транскрипции: форма А – линейный
U3 R
R U5
poly(A)
Кэп
РИС. 2.39.
Место связывания
тРНК
РНК-геном ретровируса. Каждый вирион содержит две
идентичные копии РНК. Обычно в геноме ретровирусов
присутствуют три гена - gag, pol и env; ген pol кодирует
обратную транскриптазу. Имеются также 5'-кэп и 3'-по-
Место начала синтеза
второй цепи ДНК
лиадениловый хвост (см. разд. 3.8.а). Другие особенности генома (последовательности R, U5 и т.д.) описаны в тексте.
95
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
U3 RU5
env
pol
gag
U3RU5
3'-LTR
5'-LTR
или
А
3'-LTR
5'-LTR
Б
или
В
РИС. 2.40.
Двухцепочечная ДНК, образующаяся при обратной
транскрипции ретровирусной РНК.
дуплекс ДНК с последовательностью U3RU5 [длинный концевой повтор LTR (от англ. long terminal
repeat)], имеющийся на обоих концах дуплекса; два
кольцевых дуплекса ДНК, производных формы А;
форма В с LTR-повторами на обоих концах и форма С только с одним LTR (рис. 2.40). Объяснить
образование структур А, В и С при обратной транскрипции вирусной ДНК весьма непросто. Процесс,
изображенный на рис. 2.41, начинается с наращивания тРНК-праймера на матрицах U5 и R в направлении 3'–>5' (этап 1). Затем РНКаза Н, специфичная
к РНК в составе гибридного РНК-ДНК-дуплекса,
расщепляет сегмент РНК этого дуплекса (этап
2). Поскольку на 3'-конце РНК имеется повтор R,
новосинтезированная короткая цепь ДНК «перепрыгивает» на этот конец молекулы мРНК и спаривается там с комплементарным ей участком (этап 3).
Далее происходит удлинение цепи ДНК с использованием в качестве матрицы остальной части мРНК
(этап 4). К моменту завершения синтеза первой цепи
ДНК большая часть вирусной ДНК разрушается
РНКазой Н. Затем в предполагаемом сайте связывания праймера (Рu) вблизи повтора U3 инициируется
синтез второй цепи ДНК с использованием новосинтезированной первой цепи в качестве матрицы (этап
5). Праймером для синтеза второй цепи может быть
РНК, однако как идет синтез второй цепи – непрерывно или прерывисто – неизвестно. После репликации тРНК-связывающей последовательности на 5'конце первой цепи ДНК (этап 6) тРНК, по-видимому, удаляется (этап 7). Затем новосинтезированная
вторая цепь ДНК спаривается с тРНК-связывающей
последовательностью первой цепи (этап 8). После
удлинения 3'-концов каждой цепи завершается образование дуплекса ДНК (этап 9). Обратите внимание,
что на каждом конце ДНК-дуплекса имеется прямой
повтор последовательности U3RU5 – LTR. Кольцевые ДНК, представленные на рис. 2.40, по-видимому, образуются либо путем лигирования концов
линейной ДНК (Б), либо путем гомологичной рекомбинации (разд. 2.4) между сегментами LTR (В).
Удивительно, что такая сложная последовательность реакций протекает без явного участия ферментов репликации клетки-хозяина (геликазы, прай-
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
96
тРНК
Геномная РНК
(1) Наращивание
тРНК с
ДНК
образованием
ДНК-копии 5'-конца
геномной РНК
(2) РНКаза Н удаляет
гибридизовавшуюся
РНК
(3) Первый прыжок:
ДНК гибридизуется
с R-последовательностью
на другом конце мРНК
(4) Наращивание цепи ДНК
(5) Большая часть
гибридизовавшейся РНК
удаляется РНКазой Н
(6) Синтез 3'-конца
второй цепи ДНК
(7) Удаление оставшейся части
РНК и тРНК
РИС. 2.41.
(8) Второй прыжок
(9) Синтез обеих
цепей завершен
LTR
LTR
Схематическое изображение обратной транскрипции ретровирусной
РНК, при которой образуется линейная двухцепочечная ДНК, ограниченная
LTR-последовательностями.
[J. Darnell, H. Lodish, D. Baltimore,
Molecular Cell Biology (New York:
Scientific American Books, 1986), p.
1052.]
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
Клеточная ДНК
РИС. 2.42.
Структура ретровирусной ДНК, интегрированной в клеточный геном: провирус.
мазы, ДНК-связывающего белка, лигазы, топоизомеразы и т.д.).
Репликация двухцепочечной формы ретровирусной ДНК не начинается до тех пор, пока она не
встроится в клеточную ДНК. Субстратом для такого интеграционного события является продукт обратной транскрипции – линейная дуплексная ДНК,
представленная на рис. 2.40, А. Механизм рекомбинационного встраивания пока полностью не установлен. В результате интеграции образуется структура, представленная на рис. 2.42. При интеграции
на обоих концах интегрированной вирусной ДНК
утрачивается по нескольку нуклеотидов в пределах
LTR-последовательностей и происходит дупликация
3–10 нуклеотидов клеточной ДНК. После интеграции ретровирусная ДНК реплицируется как часть
клеточной ДНК. РНК дочерних вирионов образуется в результате транскрипции интегрированных копий вирусной ДНК. Инициация синтеза РНК происходит в крайних левых точках стыковки U3R, а терминация – в крайних правых точках стыковки RU5
(рис. 2.42).
б. Некоторые ДНК-содержащие
вирусы используют для репликации
обратную транскрипцию
Геном вируса гепатита В человека представлен
кольцевой двухцепочечной ДНК с пробелами. Если
вирус находится внутри клетки, то пробелы заполняются вирионной ДНК-полимеразой. Такая почти
полноразмерная цепь ДНК играет роль матрицы, на
которой синтезируется РНК. Длина этой РНК равна
длине генома вируса, и она играет роль мРНК
в процессе экспрессии вирусных белков и роль матрицы при обратной транскрипции с образованием
дочерней вирусной ДНК. Аналогичный механизм
реализуется и при репликации вируса мозаики цветной капусты и других вирусов растений.
2.3. РЕПАРАЦИЯ ДНК
ДНК – это единственная макромолекула клетки,
которая способна устранять (репарировать) повреждения, возникающие в ее структуре. Более того,
в ней закодирована информация о механизмах са-
97
мых разнообразных репарационных процессов.
Комплементарное спаривание лежит в основе не
только репликации ДНК, но и процесса восстановления исходной структуры ДНК при репарации
повреждений, затрагивающих остов молекулы, модификаций того или иного основания или ошибочного спаривания при рекомбинации (разд. 2.4). Одновременное повреждение обеих цепей в одном месте и двухцепочечные разрывы часто оказываются
летальными для ДНК, поскольку такие дефекты
репарируются лишь в редких случаях.
Наиболее часто происходит разрыв гликозидных
связей между пурином и дезоксирибозой N (депуринизация) при повышении температуры (рис. 2.43). За
сутки в клетке человека совершается от 5000 до
10000 актов депуринизации. Если не принимать
никаких мер, то это приведет к нарушению репликации и экспрессии генов. Кроме того, остатки цитозина и аденина могут подвергаться спонтанному дезаминированию с образованием соответственно остатков урацила и гипоксантина; частота таких событий составляет примерно 100 на геном в сутки. Если
подобные нарушения в ДНК не будут устранены до
следующего раунда репликации, то они могут послужить источником мутаций.
Многие изменения в структуре ДНК происходят
под действием химических веществ, присутствующих в окружающей среде. К таким веществам относятся алкилирующие агенты (например, азотистые
соединения, алкилсульфонаты и нитрозомочевина),
которые модифицируют предпочтительно гуаниновые остатки; соединения, встраивающиеся между
соседними парами оснований и приводящие к появлению вставок и делеций во время репликации;
бифункциональные агенты, способные образовывать ковалентные сшивки между двумя цепями
ДНК и блокировать их расхождение при репликации. Не менее разрушительными могут быть и физические воздействия. Поглощение тиминовым или
цитозиновым основанием ультрафиолетового света может приводить к образованию циклобутановых димеров между соседними пиримидинами
(разд. 2.3.а); под действием ионизирующей радиации, например космических лучей, могут образовываться высокореакционноспособные свободные радикалы, оказывающие на ДНК самые разнообразные воздействия; при облучении рентгеновскими
лучами в медицинских целях в ДНК могут возникать одно- и двухцепочечные разрывы, а также
другие повреждения, характерные для воздействия
на ДНК свободных радикалов.
Как же ДНК противостоит таким разрушительным воздействиям? Благодаря какому механизму
восстанавливается нормальная структура нуклеотидов и их последовательность прежде, чем эффект
воздействия закрепится и проявится в виде мутации?
98
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Урацил
Цитозин
Гипоксатин
Аденин
Гуанин
Гуанин
Цитозин
Аденин
РИС. 2.43.
Наиболее часто встречающиеся повреждения ДНК. При
нагревании происходит депуринизация. В результате
спонтанного дезаминирования аденина и цитозина образуются соответственно гипоксантин и урацил.
Гуанин
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
99
ры; 2) удаление нуклеотидов, окружающих ошибочно спаренные или измененные пары оснований, и ресинтез этого участка путем репликации.
+
а. Репарация путем прямого
восстановления исходной структуры
Фермент—SH
(О-Метилгуанозиналкилтрансфераза)
+
РИС. 2.44.
Дезалкилирование 06-метилгуаниновых остатков катализируется специфической ДНК-алкилтрансферазой.
Известны два основных типа репарационных процессов: 1) непосредственное исправление модификаций или неправильных спариваний, не требующее
репликации для восстановления исходной структу-
Под действием алкилирующих агентов, напри1
мер N-метил-N-нитрозомочевины или N ,N-диме6
тилнитрозогуанидина, в ДНК образуются О -ме6
тил- или О -алкилзамещенные гуаниновые остатки.
Такие модифицированные остатки гуанина могут
деалкилироваться при участии ферментов, присутст6
вующих в клетках бактерий и млекопитающих. О метилгуанин-ДНК-алкилтрансфераза катализирует
перенос алкильных групп на сульфгидрильные группы цистеиновых остатков фермента, при этом акцепторный белок инактивируется (рис. 2.44). Содержание алкилтрансферазы в клетках Е. coli увеличива6
ется в присутствии О -алкилгуанина, но в клетках
млекопитающих аналогичной индуцибельности не
наблюдается.
При облучении ДНК ультрафиолетовым светом
в ней образуются циклобутановые димеры между
соседними пиримидиновыми основаниями (рис.
2.45). Такие соединения блокируют репликацию
ДНК, и для сохранения жизнеспособности клетки их
необходимо удалить. Один из способов удаления
пиримидиновых димеров состоит в ферментативном превращении их в мономеры при освещении
раствора видимым светом в диапазоне длин волн
300–600 нм (рис. 2.46). Такие фотореактивирующие
ферменты (фотолиазы) имеются у бактерий и низших эукариотических организмов, но в клетках млекопитающих они не обнаружены. Фермент образует
стабильный комплекс с пиримидиновым димером и,
используя энергию поглощенного им света, разрушает димер без разрыва цепей ДНК.
УФ
РИС. 2.45.
Образование циклобутановых димеров между соседними тиминовыми остатками, находящимися в одной цепи
ДНК.
Циклобутановое кольцо
100
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
УФ
РИС. 2.46.
Фотореактивирующий
фермент,
видимый свет
б. Репарация путем замены
модифицированных остатков
Замена модифицированного нуклеотида обычно
происходит в четыре этапа. Во-первых, фермент
распознает этот нуклеотид и надрезает полинуклеотидную цепь вблизи него либо разрывает гликозидную связь между модифицированным основани-
Образование
повреждения
Надрез
поврежденного
участка
Выщепление
поврежденного
участка
ДНК-полимераза I
заполняет пробел
ДНК-лигаза
сшивает разрыв
РИС. 2.47.
Репарация поврежденной ДНК путем замены модифицированных нуклеотидных остатков.
Образование тиминовых димеров под действием УФ-света и их разрушение на свету
при помощи фотореактивирующего фермента.
ем и дезоксирибозой. Во-вторых, экзонуклеаза удаляет модифицированный нуклеотид и/или соседние
нуклеотиды, оставляя небольшую брешь. В-третьих,
удаленный участок синтезируется заново с 3'-ОНконца с использованием в качестве матрицы противоположной цепи. В-четвертых, концы разрыва, образовавшиеся в результате репарации, соединяются
с восстановлением ковалентной целостности репарированной цепи (рис. 2.47).
Сайты, в которых произошла депуринизация или
депиримидинизация, выщепляются ферментами, называемыми АР(апуриновые и апиримидиновые)-эндонуклеазами (рис. 2.48, А). В клетках про- и эукариот имеется много разнообразных АР-эндонуклеаз,
часто по нескольку разных типов. Некоторые АРэндонуклеазы надрезают цепь с 3'-стороны АР-сайта, а другие расщепляют диэфирную связь с 3'-стороны; в любом случае образуются 3'-гидроксильный
и 5'-фосфорильный концы. Разрыв фосфодиэфирной
связи по одну или другую сторону от места нарушения (а иногда по обе стороны) позволяет экзонуклеазе удалить прилегающие остатки по обе стороны
сайта расщепления и затем ресинтезировать удаленную последовательность.
В репарации N-алкилированных пуринов и других модифицированных оснований ключевую роль
играют специфические N-гликозилазы – ферменты,
расщепляющие гликозидную связь между модифицированными основаниями и дезоксирибозой (рис.
2.48, Б). N-гликозилазы используются и при коррекции нарушений, состоящих в спонтанном дезаминировании цитозина или аденина и превращении их
соответственно в урацил или гипоксантин. Ферменты урацил-N-гликозилаза и гипоксантин-N-гликозилаза выщепляют из ДНК соответственно урацил
и гипоксантин, оставляя пробелы в месте выщепления. И вновь с помощью механизма выщепленияресинтеза восстанавливается исходная последовательность поврежденной цепи.
Урацил-N-гликозилаза играет очень важную антимутагенную роль и при исправлении ошибок,
происходящих при использовании во время репликации dUTP вместо dTTP. Поскольку спаривание
dUMP с матрицей происходит почти так же хорошо, как и dTMP, Pol III (или Pol I) его не распознает,
и если dUMP не подвергается специфическому выщеплению, то при последующем раунде репликации
в новую цепь может включиться dGMP. Таким
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
101
РИС. 2.48.
Основание
А. АР-эндонуклеазы узнают сайты, где произошла апуринизация или апиримидинизация, и гидролизуют фосфодиэфирную связь либо с 3'-,
либо с 5'-стороны от этого сайта. Б. N-гликозилазы осуществляют репарацию, гидролизуя
гликозидную связь между модифицированным
основанием и дезоксирибозой.
Основание
Специфические
АР-ДНК-эндонуклеазы
узнают
измененные
участки
Специфические ДНК-гликозилазы узнают модифицированное основание и
отщепляют его
Основание
А
Основание
Б
образом, N-гликозилаза защищает клетки от возможных мутагенных последствий включения в цепь
ДНК dUMP.
Репарация тиминовых димеров может происходить и в темноте одним из следующих двух способов. В клетках Е. coli синтезируются три полипептида, кодируемые генами uvrA, uvrB и uvrC, которые
образуют ферментный комплекс иvrАВС-эндонуклеазу. Этот фермент разрезает цепь ДНК, содержащую пиримидиновый димер, на расстоянии восьми
фосфодиэфирных связей с 5'-стороны и четырех или
пяти связей с 3'-стороны пиримидинового димера
(рис. 2.49). Удаление поврежденного участка, по-ви-
димому, катализируется геликазой, кодируемой еще
одним геном, uvrD. В результате удаляется тиминовый димер и еще примерно 12 окружающих его
нуклеотидов. Образовавшийся пробел заполняется
с помощью Pol I, а ДНК-лигаза завершает репарацию, соединяя два соседних основания цепи. Некоторые организмы используют для репарации повреждений, возникающих при образовании пиримидиновых димеров, другой механизм. Репарация осуществляется при участии пиримидиновый димер-Nгликозилазы, которая создает апиримидиновый
сайт. Гликозидная связь между одним из тиминов
и дезоксирибозой разрезается так, что тиминовый
Эндонуклеаза
Одноцепочечный разрыв
Одноцепочечный разрыв
Экзонуклеаза
РИС. 2.49.
Первый способ ферментативной репарации
циклобутановых тиминовых димеров. Ферментный комплекс uvrABC E. coli инициирует репарацию, гидролизуя цепь на расстоянии восьми фосфодиэфирных связей
от димера с 5'-стороны и четырех-пяти
связей с 3'-стороны.
ДНК-полимераза,
ДНК-лигаза
102
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
димер остается на 5'-конце разорванной цепи, а 3'ОН-группа – на дезоксирибозе (рис. 2.50). Образовавшийся 3'-АР-конец отщепляется с помощью 3'5'-экзонуклеазной активности ДНК-полимеразы, а
затем путем ник-трансляции и лигирования удаляется нуклеотид вместе с прилежащим тиминовым
димером, заполняется образовавшийся пробел и
сшиваются концы цепи.
ДНК-гликозилаза,
специфичная к пиримидиновым димерам
в. Значение репарации ДНК
У клеток в процессе эволюции выработался
сложный механизм устранения повреждений, возникающих в ДНК под действием самых разнообразных химических и физических факторов, а также
вследствие ошибок при репликации или рекомбинации. И это вполне понятно: большая часть повреждений блокирует передачу генетической информации последующему поколению, а остальные, если их
не устранить, сохранятся в геномах потомков и приведут к драматическим изменениям в молекулах
белков, а том числе и ферментов, необходимых для
поддержания жизнедеятельности клетки. При повреждении определенных звеньев системы репарации клетки становятся особенно уязвимыми для
некоторых химических и физических агентов. Например, клетки Е. coli, у которых нарушена система
внесения разрывов в ДНК при выщеплении тиминовых димеров, очень чувствительны к УФ-свету.
Клетки, неспособные осуществить ту или иную Nгликозилазную реакцию, гораздо больше, чем нормальные, подвержены мутагенному или летальному
эффекту алкилирующих агентов или ионизирующей
радиации. У клеток Е. coli, дефектных по Pol I, существенно снижена выживаемость при облучении низкими дозами УФ-света.
У представителя низших эукариот Saccharomyces
cerevisiae имеется по крайней мере пять генов, кодирующих белки, которые участвуют во внесении
разрывов в УФ-облученную ДНК. Нарушение только в одном из этих пяти RAD-генов приводит
к тому, что клетки утрачивают способность к внесению разрывов в ДНК и, следовательно, к удалению
пиримидиновых димеров. У дрожжей существуют
также мутанты с нарушенной способностью к удалению сшивок между цепями, хотя элиминация УФиндуцированных повреждений проходит нормально. Это предполагает, что у дрожжей, как и у человека, для удаления поперечных сшивок, а возможно,
и для исправления множества других химических
модификаций в ДНК существуют специфические,
весьма сложные механизмы репарации.
Люди, страдающие пигментной ксеродермой,
очень чувствительны к ультрафиолетовому свету,
и у них развиваются разные формы рака кожи даже
3'-Апиримидинэндонуклеаза
3'-Экзонуклеаза
Заполнение бреши
с помощью Pol I,
ник-трансляция
с удалением димера,
лигирование ДНК
РИС. 2.50.
Второй способ ферментативной репарации циклобутановых тиминовых димеров. N-гликозилаза, специфичная к пиримидиновым димерам, инициирует репарацию, разрывая гликозидную связь между одним из
тиминовых остатков, входящих в состав димера, и дезоксирибозой. Некоторые гликозилазы катализируют
и последующее эндонуклеазное расщепление.
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
при очень слабом воздействии солнечного света.
Клетки таких людей несут мутацию, сходную с
RAD-мутацией дрожжей и проявляющуюся в том,
что у них нарушена способность к выщеплению
пиримидиновых димеров из УФ-облученной ДНК.
Заболевание может быть обусловлено мутацией в
одном из по крайней мере девяти генов, что говорит
о достаточно сложном механизме репарации ДНК,
содержащей тиминовые димеры, у человека. Как
правило, заболевание бывает связано с неспособностью к выщеплению тиминовых димеров. Если
к облученным клеткам в культуре добавить фермент, обладающий тиминдимергликозилазной и
АР-эндонуклеазной активностями, то УФ-повреждения могут быть устранены.
2.4. РЕКОМБИНАЦИЯ ДНК
Генетическая рекомбинация включает несколько
связанных между собой процессов, в результате
которых в клетках или организмах, где они происходят, создаются новые комбинации элементов-
А
РИС. 2.51.
Обмен сестринских хроматид. Если использовать специальную методику, то можно увидеть, как в метафазных хромосомах происходит обмен между двумя продуктами дупликации хромосом (сестринскими хроматидами). Методика вкратце состоит в следующем: клетки проходят одно деление в присутствии бромдезоксиуридина, а второе - в его отсутствие. Краситель Hoechst
33258 в комплексе с ДНК, содержащей бромдезоксиуридин, флуоресцирует значительно слабее, чем в
комплексе с обычной тиминсодержащей ДНК. Поэтому
103
носителей генетической информации. Рекомбинация
между близко расположенными гомологичными
хромосомами приводит к интенсивной перетасовке
отцовских и материнских генов в ходе мейоза и тем
самым создает предпосылки для эволюционной
проверки новых комбинаций этих генов в потомстве. Как правило, рекомбинационные события, происходящие в соматических клетках либо во время
репликации ДНК, либо после нее и проявляющиеся
в виде обмена сестринских хроматид (рис. 2.51), не
приводят к изменению генотипа или фенотипа клетки. Однако нередко они порождают различные геномные перестройки. Это, например, утрата, приобретение или амплификация генетических элементов и установление новых взаимосвязей между уже
имеющимися, но по-новому расположенными элементами.
Если использовать молекулярные термины, то
можно сказать, что генетическая рекомбинация состоит в образовании ковалентных связей между
нуклеотидными последовательностями из разных
областей одной и той же или разных молекул ДНК.
Б
сестринские хроматиды, образовавшиеся во втором
клеточном цикле, имеют более интенсивную окраску.
Обмен сестринских хроматид выявляется по неравномерности интенсивности флуоресценции. А. Хромосомы из нормальных периферических лимфоцитов человека. Б. Хромосомы из периферических лимфоцитов
больных с синдромом Блума. [S.A. Latt, R. Schreck,
Amer. J. Hum. Genet., 32 (1980), p. 294.] Микрофотографии любезно предоставлены S.A. Latt.
104
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Все клетки и многие вирусы содержат информацию
о синтезе ферментов, предназначенных не только
для репарации повреждений в собственной ДНК, но
и ферментов, осуществляющих рекомбинацию. На
самом деле некоторые ферменты, участвующие в
репликации и репарации ДНК, играют ключевую
роль и при рекомбинации. В этом разделе мы
рассмотрим механизмы некоторых рекомбинационных процессов и ферменты, которые их катализируют. Особое внимание будет обращено на рекомбинацию у бактерий и фагов, поскольку у них эти
процессы довольно хорошо изучены. Несмотря на
то что генетические и морфологические аспекты
рекомбинации в эукариотических клетках известны,
на молекулярном уровне здесь многое остается
неясным.
а. Типы рекомбинации
Существуют три типа рекомбинации: общая, или
гомологичная, сайт-специфическая и случайная, или
негомологичная.
Общая рекомбинация. Общая рекомбинация происходит, как правило, между протяженными участками идентичных или гомологичных нуклеотидных
последовательностей. Ее часто называют гомологичной рекомбинацией или кроссинговером. При общей рекомбинации происходит разрыв двух гомологичных участков ДНК, и каждый из концов одного
сегмента соединяется с соответствующими концами
другого таким образом, что обе образующиеся молекулы содержат разные фрагменты обеих участвующих в рекомбинации ДНК (рис. 2.52). На самом
деле сайты, по которым происходят разрыв и воссоединение каждой из двух цепей, очень часто не
совпадают.
Обычно общая рекомбинация происходит между
гомологичными и аллельными участками разных
молекул ДНК, но она может произойти и между
гомологичными, но неаллельными областями рекомбинирующих молекул. В этом случае один из
продуктов рекомбинации утрачивает часть ДНК,
РИС. 2.52.
Гомологичная рекомбинация, или кроссинговер.
РИС. 2.53.
Неравный кроссинговер.
а другой приобретает «лишний» сегмент. Такой
процесс получил название неравного кроссинговера
(рис. 2.53). Иногда рекомбинация происходит между неаллельными участками одной и той же хромосомы (например, между повторяющимися последовательностями ДНК) с соответствующей потерей
области, лежащей между сайтами рекомбинации
(рис. 2.54). В отличие от уже рассмотренных случаев
некоторые рекомбинационные события нереципрокны; как следствие, один из образовавшихся продуктов идентичен одной из исходных молекул, а другой
отличается от обоих партнеров (рис. 2.55). Такой
процесс часто называется генной конверсией.
Сайт-специфическая рекомбинация. Рекомбинация называется сайт-специфической, если сайты разрыва и воссоединения в двух рекомбинирующих
молекулах или двух фрагментах одной и той же
молекулы ДНК находятся в пределах довольно
коротких специфических гомологичных нуклеотидных последовательностей – как правило, не более 25
нуклеотидов. Такие короткие последовательности
может иметь только один из партнеров (рис. 2.56)
или оба (рис. 2.57). В качестве примера первого
варианта можно привести транспозиции некоторых
мобильных элементов у эу- и прокариот (разд. 10.2
и 10.3), а второго – процесс интеграции-выщепления
ДНК фага λ из хромосомы Е. coli (разд. 2.4.г).
С помощью сайт-специфической рекомбинации происходят запрограммированные перестройки хромосомной ДНК при смене типов спаривания у дрожжей; она ответственна также за разнообразие антител (разд. 10.6). По-видимому, общая рекомбинация
между любыми парами гомологичных последовательностей осуществляется с помощью одного и того же комплекса ферментов; с другой стороны, для
каждого случая сайт-специфической рекомбинации
необходим свой набор ферментов.
105
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
+
Рекомбинация
+
РИС. 2.54.
Внутримолекулярная рекомбинация.
Негомологичная рекомбинация.
Рекомбинация
между негомологичными нуклеотидными последовательностями происходит в клетках прокариот и
дрожжей достаточно редко, а в клетках млекопитающих – весьма часто. К негомологичной рекомбинации можно отнести процесс случайного встраивания вирусной или плазмидной ДНК в ДНК клеток
животных, в результате чего в реплицирующихся
геномах паповавирусов появляется множество делеций и дупликаций. Концы разорванной ДНК могут
соединиться, даже если они негомологичны. В некоторых случаях рекомбинация происходит между
последовательностями, содержащими несколько гомологичных пар оснований, или между короткими
Генная конверсия
РИС. 2.55.
Нереципрокная рекомбинация, или генная конверсия.
Рис. 2.56.
Сайт-специфическая рекомбинация, при которой специфический сайт имеется только в одном участвующем
в рекомбинации фрагменте ДНК. Специфическими сайтами рекомбинации являются концы участка Т, а сам
участок может рекомбинировать со случайными последовательностями ДНК, расположенными, например,
между участками В и С (вверху) или в пределах участка
D (внизу).
частично гомологичными участками. Но, как правило, рекомбинирующие сегменты не имеют гомологичных последовательностей.
б. Общая рекомбинация между
гомологичными молекулами ДНК
Общая рекомбинация при согласованном внесении
разрывов и воссоединении цепей двух спиралей ДНК
с образованием протяженных гетеродуплексных областей. Чтобы могла произойти рекомбинация
между двойными спиралями, представленная на
рис. 2.52, каждая из четырех цепей должна быть
разорвана и затем соединена с новым партнером.
Этапы этого процесса показаны на рис. 2.58. Соответствующие цепи обоих линейных гомологичных
дуплексов ДНК надрезаются и свободные концы
одной спирали спариваются с комплементарными
участками другой (а-г). Перекрест стабилизируется
сшиванием концов донорных цепей со свободными
концами реципиентных спиралей (д). Точка перекреста обменивающихся цепей перемещается вдоль
106
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 2.57.
Сайт-специфическая рекомбинация, при которой специфические последовательности имеются в обеих
участвующих в рекомбинации ДНК. На рисунке представлена интеграция ДНК фага λ с хромосомной ДНК
Е. соli. [В. Alberts et al.. Molecular Biology of the Cell (New
York: Garland, 1983), p. 248.]
Геном бактериофага λ
(кольцевая
двухцепочечная ДНК)
Специфические
последовательности,
по которым
происходит встраивание
Хромосомная ДНК
Белковый комплекс
катализирует согласованное
образование
двухцепочечного разрыва и
воссоединение дуплексов
Белок
ДНК бактериофага
встроилась в
хромосомную ДНК
спиралей – процесс, называемый миграцией ветви (е).
При этом происходит одновременное расхождение
цепей исходных спиралей и их реассоциация с новыми партнерами с образованием дочерних дуплексов.
Структуры д и е, а также ж называются структурами Холлидея по имени исследователя, впервые их
предложившего.
Структуры Холлидея могут переходить в рекомбинантные двойные спирали путем внесения разрыва и воссоединения цепей двумя альтернативными
способами. Один способ состоит в разрезании и воссоединении перекрещивающихся цепей. Два реципрокных продукта л и м могут образоваться, если
разрыв и последующее воссоединение цепей произойдут в точке перекреста в структурах е и д или
по линии пересечения четырех цепей в изомерной
структуре Холлидея и. Размер обменивающихся
фрагментов зависит от расстояния, на которое про-
изошла миграция ветви до акта рекомбинации. Альтернативные продукты н и о образуются в том
случае, если структура Холлидея з переходит в результате разрыва в к.
В основе рекомбинации данного типа лежит
гомологичное спаривание цепей, принадлежащих
двум разным спиралям ДНК, поэтому скорее всего
она произойдет в том месте, где такое спаривание
возможно a priori и где гомологичность последовательностей достаточно велика, чтобы могла произойти миграция ветви в рамках структуры со скрестившимися цепями. Отсюда можно понять, почему
общая, или гомологичная, рекомбинация происходит также между двумя повторами в пределах одной молекулы ДНК или между аллельными и неаллельными элементами одной и той же последовательности в двух разных хромосомах (рис. 2.53 и 2.54).
В ходе миграции ветви при спаривании цепей,
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
107
РИС. 2.58.
Этапы процесса рекомбинации между гомологичными
дуплексными ДНК (объяснения см. в тексте).
принадлежащих разным спиралям, образуются гетеродуплексы. В таких гетеродуплексах в пределах
сегмента между сайтом начала образования структуры Холлидея и сайтом кроссинговера может содержаться по одному или более ошибочно спаренных оснований (рис. 2.58). Они удаляются так же,
как любые модифицированные основания при репарации ДНК (разд. 2.3.б). Однако, поскольку удалено может быть любое из ошибочно спаренных
оснований, в обеих рекомбинантных спиралях в данном сайте могут оказаться одинаковые пары осно-
ваний, т.е. рекомбинация для этого сайта окажется
нереципрокной (рис. 2.59). Таким образом, каждая
из рекомбинантных спиралей может быть похожа на
любой из начальных дуплексов в тех позициях, где
исходно они различались.
Общая рекомбинация с образованием двухцепочечного разрыва. Альтернативный механизм общей рекомбинации включает образование двухцепочечного разрыва в одном из дуплексов-партнеров (рис.
2.60). Далее с помощью экзонуклеаз в месте разрыва
образуется брешь. При спаривании 3'-одноцепочеч-
108
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 2.59.
Продукты, образующиеся при неправильном спаривании в процессе гомологичной рекомбинации при репарации гетеродуплексов.
+
Гетеродуплексы, образующиеся
из структур Холлидея
Исправление ошибок, происходящих при спаривании
или
ного конца бреши с комплементарной цепью интактной спирали в последней образуется петля.
Размер этой петли увеличивается по мере того, как
ДНК-полимераза наращивает 3'-конец «вклинившейся» цепи. В итоге другой одноцепочечный конец
бреши спаривается с комплементарной последовательностью в перемещающейся петле. В результате
такого спаривания образуется система «праймерматрица», и ДНК-полимераза синтезирует недостающую цепь, заполняя брешь. Лигирование двух
растущих концов с исходными цепями приводит
к образованию двойной структуры Холлидея (т.е.
структуры, в которой две спирали объединены двумя перекрестами, по одному на каждом конце бреши). Миграция ветви в одном или обоих перекрестах передвигает оба места сцепления в любом направлении, при этом в участках, фланкирующих
брешь, могут возникать ошибки. Разделение таких
структур может идти двумя способами – с перекрестом и без него (рис. 2.58), с образованием четырех
дуплексов (рис. 2.60).
Необходимо отметить некоторые особенности
этого механизма. Образование ошибочных пар (гетеродуплексов) в районах, фланкирующих брешь,
обусловливает получение как реципрокных, так и нереципрокных рекомбинаций между генетическими
маркерами. Если двухцепочечный разрыв происходит вблизи (или в пределах) участка, где между
спиралями имеются различия (замены оснований,
делеции, вставки, инверсии и т.п.), то рекомбинанты унаследуют нуклеотидную последовательность
партнера, у которого разрыва не происходило. Этот
механизм объясняет многие случаи генной конверсии, особенно те, в которых протяженная последо-
или
вательность одного дуплекса замещается соответствующей, но отличающейся последовательностью
другого дуплекса.
Нереципрокная общая рекомбинация используется и при репарации некоторых повреждений ДНК.
Например, если тиминовые димеры не были удалены из УФ-облученной ДНК до того, как к ним
подошла репликативная вилка, то синтез комплементарной цепи в этом участке не может быть
завершен (рис. 2.61). Поскольку тиминовые димеры,
находящиеся напротив бреши, не могут быть выщеплены, остается один путь для спасения хроматиды – использовать генетическую информацию гомологичной сестринской хроматиды и заполнить
брешь. Для этого применяется такой же механизм,
как для репарации брешей (рис. 2.60).
в. Ферменты,
участвующие в общей рекомбинации
В общей рекомбинации участвуют два специфических фермента и еще несколько ферментов, катализирующих также процессы репликации и репарации ДНК. Энзимология общей рекомбинации изучена только для некоторых прокариотических организмов, в частности E. coli и ее фагов. Один из
специфических ферментов, необходимых для успешной гомологичной рекомбинации, называется recАбелком. Он катализирует обмен одиночными цепями, используя энергию гидролиза АТР до ADP
и неорганического фосфата (рис. 2.62). RecA-зависимое внедрение одноцепочечных ДНК в дуплекс –
первый этап рекомбинационного процесса в рамках
обеих схем Холлидея (рис. 2.58) и механизма с обра-
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
109
Двухцепочечный разрыв
Экзонуклеазное расщепление
Образование петли
Увеличение размера петли
с помощью Pol I
Репарация брешей
и миграция ветви
Образование конечных
продуктов
Без перекреста
+
или
РИС. 2.60.
С перекрестом
+
зованием двухцепочечных разрывов (рис. 2.60). Второй фермент, состоящий из трех отдельных субъединиц (В, С и D) и поэтому называемый recBCD-нуклеазой, обладает эндо- и экзонуклеазной, а также
геликазной активностями. Механизм его действия
до конца не установлен, однако известно, что
recBCD-нуклеаза индуцирует разрывы в дуплексной
ДНК и благодаря присущей ей геликазной активности вместе с recА инициирует рекомбинационный
Общая рекомбинация с образованием двухцепочечного разрыва.
процесс. Идентифицирован также фермент, разрезающий узлы в структурах Холлидея; при его участии
образуются липкие концы, соединяемые лигазой.
В общей рекомбинации участвуют также геликазы и белки, связывающиеся с одноцепочечной ДНК
(SSB; от англ. single strand binding); оба они необходимы для обеспечения процесса миграции ветви.
Как известно, перемещению цепей во время миграции ветви способствует Pol I, а в воссоединении
110
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Репарированный сегмент
Пиримидиновый димер
Обычная
репарация
пиримидинового
димера
Репарация бреши
Донорный сегмент,
использующийся
для репарации бреши
РИС. 2.61.
Нереципрокная гомологичная рекомбинация как один
из этапов репарации ДНК в месте образования пиримидиновых димеров.
разорванных цепей участвует ДНК-лигаза. Для снятия топологических ограничений при раскручивании
спирали и для распутывания перекрученных структур, по-видимому, нужны топоизомераза типа I и,
возможно, гираза.
г. Сайт-специфическая
рекомбинация
RecA-белок,
SSB
АТР
SSB
АТР
RесА-белок,
SSB
ADP + Pi
Сайт-специфическая рекомбинация происходит
между специфическими сегментами дуплексов ДНК,
не имеющими протяженных гомологичных участков. Характерным примером такой рекомбинации
служит интеграция кольцевой ДНК фага λ с хромосомой Е. coli и ее обратное выщепление. Несмотря
на то что эти рекомбинационные события также
включают разрыв и воссоединение двух спиральных
сегментов ДНК, их механизм абсолютно отличен от
механизма общей рекомбинации. В этом случае
рекомбинация происходит в пределах специфической нуклеотидной последовательности ДНК фага
λ (attP-сайт) и уникальной последовательности
ДНК Е. coli (аttВ-сайт) (рис. 2.63). Нуклеотидные
последовательности attP- и attВ-сайтов (рис. 2.64)
совершенно различны, хотя имеют общее ядро (О)
протяженностью в 15 нуклеотидных пар. AttP
(POP') простирается на 150 нуклеотидов влево (Р)
и на 75 нуклеотидов вправо (Р') от общего ядра,
a attB (BOB') – это сегмент длиной всего около 25
нуклеотидов, включая и ядро. Рекомбинационные
события, происходящие как при интеграции, так
и при исключении ДНК фага λ из хромосомы Е. coli,
изображены на рис. 2.63 (фрагменты ДНК представлены в виде линейных структур).
Поскольку нуклеотидные последовательности,
РИС. 2.62.
Одноцепочечный
разрыв
RecA-зависимая общая рекомбинация ДНК E. coli. Процесс ускоряется присоединением белка, связывающегося с одноцепочечной ДНК (SSB). [M. Cox, I.R. Lehman,
Proc. Natl. Acad. Sci. USA, 78 (1981), p. 3433.]
111
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
исключении фаговой ДНК помимо белка Int необходимы фаговый белок xis и клеточный белок HF.
Процесс рекомбинационного выщепления, по-видимому, имеет некоторое сходство с процессом интеграции, но роль указанных трех белков, особенно
белка xis, все еще изучается.
attP
ДНК фага λ
attB
2.5. РЕПЛИКАЦИЯ
ДНК
Е. coli
Кор
Int + xis + HF
attL
РИС. 2.63.
lnt + HF
attR
Встроенная ДНК фага λ
Встраивание кольцевой ДНК фага λ в хромосому Е. coli.
Сайт attB расположен между генами gal и bio ДНК
Е. coli. Для встраивания необходимы белок, кодируемый
фаговым геном int, и бактериальный белок HF. Для
выщепления ДНК фага λ необходимы эти два белка
и еще один фаговый белок, кодируемый геном xis.
фланкирующие attP- и attВ-сайты слева (attL) и
справа (attR), для этих сайтов различаются, механизм рекомбинационного выщепления ДНК фага
λ из ДНК Е. coli должен отличаться от механизма их
рекомбинационной интеграции (рис. 2.63). И действительно, для рекомбинации между attL и attR при
Образование РНК-содержащих вирусов происходит путем репликации их РНК, тогда как все клеточные РНК образуются в результате транскрипции
ДНК (гл. 3). Здесь мы рассмотрим лишь процесс
репликации вирусной РНК как таковой, не касаясь
связи репликации с жизненным циклом соответствующих вирусов.
За исключением ретровирусов (разд. 2.2), репликация РНК в основном повторяет процесс репликации ДНК. Цепи РНК также удлиняются на один
нуклеотид за один акт в направлении 5'–>3' путем
присоединения рибонуклеотидтрифосфата к 3'-ОНконцу растущей цепи. Как и при репликации ДНК,
порядок расположения нуклеотидов определяется
комплементарным копированием матрицы, в данном случае обязательно цепи РНК (рис. 2.65). Ферменты, осуществляющие этот процесс, называются
РНК-зависимыми репликазами.
РНК бактериальных вирусов R17 и MS2, а также
полиовирусов и вируса Синдбис, инфицирующих
животных, всегда обозначается знаком (+), поскольку последовательность их РНК-геномов иденПоследовательности POP' и BOB'
Последовательности
РИС. 2.64.
Обычные нуклеотидные последовательности attP- и
attB-сайтов, по которым происходит сайт-специфическая рекомбинация.
РОВ' и ВОР'
112
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Матричная цепь РНК
Растущая цепь РНК
РИС. 2.65.
РНК-зависимый синтез РНК.
Направление
матричной
цепи 5'–3'
Присоединяемый
рибонуклеозидтрифосфат
Рост цепи в направлении
5'–3'
тична последовательности мРНК. Таким образом,
геном инфицирующего вируса может служить в качестве мРНК и содержит информацию о синтезе
некоторых, если не всех, вирусных белков. Специфическая репликаза, кодируемая геномом вируса и образующаяся вскоре после инфекции, связывается
с одним или несколькими белками клетки-хозяина
и инициирует процесс копирования (+)-цепи с ее
3'-конца с образованием полной (–)-цепи, ассоциированной с (+)-цепью-матрицей (рис. 2.66, А). Затем
та же репликаза, возможно вместе с другими вирусными белками, синтезирует множество копий (+)цепи РНК, используя новосинтезированную (–)-
цепь в качестве матрицы. С единственной (–)-матричной цепи РНК синтезируется одновременно несколько новых (+)-цепей (рис. 2.67). У многих вирусов копирование (+)- или (–)-цепей инициируется
путем спаривания рибонуклеозидтрифосфата с первым нуклеотидом на 3'-конце матричной цепи.
(+)-Цепь РНК полиовируса реплицируется способом, аналогичным представленному на рис.
2.66, А, но его геномная РНК имеет одну особенность – к ее 5'-концу с помощью фосфодиэфирной
связи присоединен белок через тирозиновый остаток. У (–)-цепи, синтезируемой в первом раунде
репликации, этот белок отсутствует. Однако все
2. РЕПЛИКАЦИЯ, СОХРАНЕНИЕ И МОДИФИКАЦИЯ ГЕНОМА
А
113
РИС. 2.66.
Репликация плюс-цепи РНК-геномов
Вирусная РНК
Комплементарное копирование
плюс-последовательности
Репликация плюс- (А) и минус(Б) цепей вирусной РНК по механизму РНК-зависимого синтеза
РНК.
Репликативная
форма
Комплементарное копирование
минус-последовательности
Дочерние РНК
Б
Репликация минус-цепи РНК-геномов
Вирусная РНК
Комплементарное копирование
минус- последовательности
Репликативная
форма
Комплементарное копирование
плюс-последовательности
Дочерние РНК
(+)-цепи, образующиеся на (–)-цепи как на матрице, содержат 5'-концевой белок, даже когда их длина
еще очень мала. Это позволяет предположить, что
репликаза полиовирусов использует гидроксильную
группу тирозина в качестве праймера при инициации новых (+)-цепей, в то время как (–)-цепи
фермент может инициировать de novo.
Геном некоторых вирусов (в том числе вируса
везикулярного стоматита) представлен одной цепью
РНК, нуклеотидная последовательность которой
комплементарна, а не идентична последовательности мРНК. Такие геномы обозначают знаком (–).
Существуют также вирусы (вирусы гриппа), геном
которых состоит из множественных (–)-цепей РНК,
при этом каждый такой сегмент соответствует одному или двум вирусным генам. Если геном вируса
представлен одной или более (–)-цепями РНК, то
в самом вирионе содержится комплекс геномной
РНК со специфической репликазой. После проникновения в клетку комплекс активируется, и на (–)цепях как на матрицах синтезируются (+)-цепи
(рис. 2.66, Б). Новосинтезированные (+)-цепи играют роль мРНК для синтеза новых или дополнительных репликационных белков и роль матрицы при
синтезе дочерних (–)-цепей. Новые (–)-цепи синтезируются по механизму, представленному на рис.
114
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Вирусная РНК
Комплементарное копирование
с помощью комплекса
вирусная репликазабелок хозяина
Репликативная
форма
Промежуточные
продукты
Дочерние
РНК
РИС. 2.67.
Одновременный синтез нескольких плюс-цепей РНК на
единственной РНК-матрице.
2.67 для синтеза (+)-цепей вирусов.
Геном некоторых вирусов (в частности, реовирусов) представлен двухцепочечной РНК, содержащей
и (+)-, и (–)-цепи. Репликация у таких вирусов
также инициируется ферментами, содержащимися
в самом вирионе. Эти ферменты копируют (–)-цепь
дуплекса РНК консервативным путем (т.е. исходная
двухцепочечная РНК сохраняется, а новые (+)-цепи
отделяются). Белки-репликазы, транслируемые с
этих (+)-цепей мРНК, синтезируют затем комплементарные (–)-цепи, которые, объединяясь с (+)цепями, образуют дочерние двухцепочечные РНК
вируса.
Имеющиеся данные о структуре и функции РНКрепликаз весьма ограниченны. Наиболее детально
изучена РНК-репликаза, синтезируемая РНК-содержащим колифагом Qβ. Она состоит из четырех идентичных полипептидов, причем только один из них кодируется вирусным геномом. Этот полипептид не способен реплицировать (+)-цепи вируса, он может катализировать только ограниченную реакцию присоединения рибонуклеотидов. Остальные три белка, входящие в состав РНК-репликазы фага Qβ, являются
компонентами хозяйского аппарата синтеза белка, и
их точная функция в процессе репликации РНК неизвестна. Инициация и репликация, осуществляемые
РНК-репликазой, кодируемой вирусами животных,
также зависит от активности белков, образуемых
клеткой-хозяином. Отличительная особенность РНКрепликаз состоит в их необычной способности специфически узнавать нуклеотидные последовательности на 3'-концах как (+)-, так и (–)-цепей, что
гарантирует инициацию синтеза новых цепей.
Глава 3
АППАРАТ ЭКСПРЕССИИ ГЕНОВ
И ЕГО ЛОГИКА
В основу концепции взаимосвязи генотипа и фенотипа была положена теория «один ген – один фермент». Однако эта теория не учитывала молекулярную природу носителей генетической информации
и способ передачи этой информации от генов к белкам. Не содержала она и никаких предположений
о механизме регуляции экспрессии генов. Прогресс
в этих областях наметился сразу после того, как
были установлены следующие ключевые положения:
1) показано, что гены – это участки ДНК; 2) расшифрована молекулярная структура ДНК; 3) установлено, что структура и функция белков определяются их уникальной аминокислотной последовательностью; 4) обнаружено, что передача информации от ДНК к белкам осуществляется с помощью
РНК; 5) разработаны относительно простые бактериальные генетические системы, позволяющие связать мутационные изменения в генах со структурными изменениями в соответствующих белках; 6) разработаны системы для изучения синтеза РНК и
сборки белков in vitro.
ДНК и информационно связанные с ней молекулы РНК и белков можно представить как одномерные структуры, состоящие из множества мономерных единиц. В ДНК информация записана в виде
последовательно расположенных дезоксинуклеотидных пар, образующих длинные цепи, а в РНК – в
виде последовательности рибонуклеотидов. Уникальность белков определяется линейной последовательностью аминокислот в их полипептидной цепи.
Природу информационной связи между ДНК и белками удалось понять, проводя генетические и биохимические исследования мутаций в данном гене и сопоставляя их со специфическими изменениями в
аминокислотной последовательности соответствующего белка. Благодаря этим исследованиям была
выявлена также коллинеарность последовательностей нуклеотидов в ДНК и аминокислот в белках.
Наличие такой корреляции подразумевало существование генетического кода, связывающего нуклеотидные и аминокислотные последовательности обоих полимеров. Но какова природа этого кода? И в
частности – как последовательности ДНК, состоящие всего из четырех нуклеотидов, могут детерминировать белковые последовательности, состоящие
не менее чем из 20 аминокислот? Какие химические
процессы управляют трансляцией генетического кода и как они регулируются при формировании
свойственных разным клеткам и организмам фенотипов?
Сейчас природа генетического кода известна,
составлен словарь, переводящий нуклеотидную последовательность в аминокислотную. Установлены
и основные особенности различных этапов экспрессии генов и их регуляции, хотя многие молекулярные детали еще ждут своего разъяснения. В этой
главе мы рассмотрим, как устроен генетический
словарь, и опишем механизмы, используемые клеткой для экспрессии генетической информации. Основное внимание будет уделено прокариотам, но мы
вкратце остановимся на соответствующих процессах и у эукариот. Последние данные об этих процессах у эукариот приведены в гл. 8.
3.1. ОСНОВНЫЕ ПОЛОЖЕНИЯ
ПРОЦЕССА ЭКСПРЕССИИ ГЕНОВ
Экспрессия генов – это процесс реализации информации, закодированной в структуре ДНК, на
уровне РНК и белков. Прежде чем переходить
к детальному описанию и анализу этих процессов,
мы вкратце рассмотрим суть экспрессии генов – ее
механизм и регуляцию.
а. Транскрипция ДНК в РНК
Экспрессия всех генов начинается с транскрипции их нуклеотидной последовательности, т.е. перевода ее на язык РНК. При этом определенный
участок одной из двух цепей ДНК используется как
матрица для синтеза РНК путем комплементарного
спаривания оснований. В результате транскрипции
генов, в которых закодирована структурная информация о белках, образуются молекулы мРНК; другие гены кодируют молекулы РНК, являющиеся
частью аппарата, необходимого для трансляции
мРНК с образованием белков. У прокариот, например Е. coli, ДНК транскрибируется с помощью одного фермента – ДНК-зависимой РНК-полимеразы,
который участвует в синтезе всех типов РНК. В отличие от прокариот эукариоты имеют три разные
ДНК-зависимые РНК-полимеразы, каждая из которых ответственна за транскрипцию генов, кодирующих разные типы клеточных РНК (гл. 8). Несмотря
на то что механизмы синтеза РНК и матричного
копирования для всех РНК-полимераз идентичны,
116
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
каждый фермент узнает в матрице ДНК свои характерные особенности, определяющие сайты инициации, терминации и регуляции транскрипции.
б. Соответствие
между нуклеотидными триплетами
и аминокислотами
Генетический код устанавливает соответствие
между нуклеотидной последовательностью данной
мРНК и аминокислотной последовательностью синтезируемой на ней полипептидной цепи. Размер
единиц кодирования и сами эти единицы, однозначно задающие ту или иную аминокислоту (кодоны),
практически одинаковы у всех живых организмов.
Более того, основные принципы и механизмы перевода генетических посланий также универсальны.
Генетический словарь содержит 64 кодона, каждый из которых образован тремя последовательными нуклеотидами (триплетами). 61 из 64 кодонов
детерминируют 20 аминокислот, обнаруженных в
белках, один определяет начало большинства последовательностей, кодирующих белки, и три обозначают окончания этих последовательностей.
Отличительной особенностью генетического кода является то, что каждый кодон кодирует только
одну аминокислоту, т.е. код однозначен. Следовательно, зная словарь и правила пользования им,
можно перевести нуклеотидную последовательность
мРНК в определенную аминокислотную последовательность. Но генетический код является вырожденным. Это означает, что одной аминокислоте
могут соответствовать несколько кодонов. Вырожденность генетического кода приводит к тому, что
нельзя однозначно перевести аминокислотную последовательность данного белка в нуклеотидную
последовательность соответствующей мРНК.
в. Расшифровка кода
с помощью тРНК
Аминокислоты не взаимодействуют с соответствующими им кодонами непосредственно. Каждая
аминокислота вначале связывается с адаптером –
родственной тРНК, и образующаяся при этом аминоацил-тРНК узнает «родственный» кодон путем
комплементарного спаривания оснований. Таким
образом, декодирование осуществляется с помощью
спаривания оснований триплетных кодонов мРНК
с триплетными антикодонами в аминоацил-тРНК.
Присоединение аминокислот через карбоксильные группы к родственным тРНК катализируют
ферменты, называемые аминоацил-тРНК-синтетазами. При связывании тРНК с аминокислотой карбоксильная группа последней активируется, и в ре-
зультате образование пептидных связей становится
энергетически выгодным. Энергия же, необходимая
для активации аминокислоты при присоединении ее
к тРНК, поступает от гидролиза АТР.
Присоединение аминокислот к родственным
тРНК осуществляется с помощью специфических
ферментов. Так, тирозил-тРНК-синтетаза присоединяет L-тирозин только к тем тРНК, которые могут спариться с тирозиновым кодоном. Аналогично
лейцил-тРНК-синтетаза катализирует присоединение лейцина к молекулам тРНК, которые узнают
кодоны лейцина. Таким образом, специфичность
декодирования обеспечивается двумя реакциями:
точным присоединением каждой аминокислоты к
родственной ей тРНК и комплементарным спариванием антикодонов аминоацил-тРНК с соответствующими им кодонами в мРНК.
г. Правильная инициация трансляции
Имеются три «рамки считывания», при которых
может осуществляться перевод последовательных
нуклеотидных триплетов мРНК в аминокислоты.
Правильная инициация трансляции чрезвычайно
важна для точной расшифровки генетического кода.
Выбор рамки считывания зависит от того, какое
сочетание из трех последовательных нуклеотидов
выбрано в качестве первого кодона. Ниже приведены три возможные рамки считывания для последовательности GUACGUAAGUAAGUAUGGACGUA:
Рамка
считывания 1
Рамка
считывания 2
Рамка
считывания 3
GUA CGU AAG UAA GUA UGG ACG
..G
UAC GUA AGU AAG UAU GGA CGU
.GU
ACG UAA GUA AGU AUG GAC GUA
Обычно аминокислотной последовательности
кодируемой полипептидной цепи соответствует
только одна из рамок. Следовательно, должен существовать какой-то способ инициации трансляции
с правильной рамкой считывания. У всех организмов, изученных к настоящему времени,– бактерий,
вирусов и эукариот – правильная рамка считывания
определяется с помощью механизма, распознающего специфический кодон, который детерминирует
концевую аминокислоту синтезируемого белка.
Почти всегда таким кодоном является триплет
AUG, отвечающий метионину. Поэтому образующийся полипептид неизменно содержит на N-конце
метионин, но при последующем удалении аминоконцевой последовательности на N-конце конечного
белкового продукта оказывается аминокислота, находящаяся изначально внутри синтезированной полипептидной последовательности. В рассмотренном
выше примере кодон AUG, с которого может начаться транскрипция, содержит рамка считывания 3.
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
д. Трансляция кодонов
и соединение аминокислот
Последовательное спаривание разных аминоацил-тРНК с кодонами мРНК и рост полипептидной
цепи осуществляются с помощью целой серии взаимно согласованных реакций. Одним из главных
участников этого в высшей степени скоординированного процесса является рибосома – особый мультиферментный комплекс, состоящий из нескольких
видов РНК и множества белков. Кроме того, целая
армия ферментов и различных факторов катализирует мириады химических событий, необходимых
для успешного синтеза белка.
Рибосомы, несущие особую инициаторную метионил-тРНК, находят инициаторный кодон в
мРНК, AUG, и связываются с ним. Затем с рибосомой связывается аминоацил-тРНК, соответствующая второму кодону, и при участии рибосомной
ферментативной активности остаток метионина соединяется со второй аминокислотой, все еще связанной со «своей» тРНК. В результате образуется
дипептидил-тРНК. По мере продвижения рибосомы
по цепи мРНК и считывания каждого последующего
кодона полипептидная цепь удлиняется на одну
аминокислоту за один шаг. Элонгация прекращается в тот момент, когда рибосома достигает одного
из трех терминирующих кодонов. Завершенная полипептидная цепь тотчас же высвобождает последнюю тРНК, и происходит разделение рибосомы
и мРНК.
е. Регуляция экспрессии генов
на разных этапах образования
РНК и белка
Клетки про- и эукариот обладают способностью
к дифференциальной регуляции экспрессии генов.
Так, при определенных условиях многие гены вообще не экспрессируются, а степень экспрессии других
различается на несколько порядков. Изменение условий может привести к активации «молчавших»
ранее генов и репрессии активно работавших. Подобная способность позволяет клеткам приспособить свои фенотипы к самым разнообразным условиям окружающей среды и физиологическим воздействиям. Дифференцированная экспрессия одного
генома у многоклеточных организмов обусловливает развитие огромного множества типов клеток,
имеющих специфические функции, из одной или
нескольких зародышевых клеток.
Экспрессия генов, как правило, регулируется на
уровне образования РНК. Обычно регулируемым
этапом является инициация транскрипции, при этом
регуляция осуществляется либо с помощью репрессорных белков, предотвращающих транскрипцию,
117
либо с помощью активаторных, необходимых для ее
начала. В первом случае транскрипция начинается
только после того, как инактивируется репрессорный белок. Во втором ген транскрибируется лишь
тогда, когда белок-активатор находится в соответствующем функциональном состоянии. В регуляции
транскрипции генов участвуют не только репрессорные и активаторные белки. В некоторых случаях
сами белки – продукты генной экспрессии – оказываются регуляторами транскрипции собственных генов. Эффективность транскрипции зависит также от
конформационного состояния ДНК или РНК. Кроме того, регуляция синтеза РНК может осуществляться путем контроля скорости ее элонгации или
с помощью «стоп-сигнала» в транскрибируемой последовательности, который может остановить транскрипцию гена. Модификация и/или процессинг,
которые могут предшествовать образованию зрелой функциональной РНК, также регулируются.
Экспрессия генов может регулироваться и на
уровне трансляции мРНК с образованием белков.
И в этом случае специфическая регуляция, как правило, осуществляется на начальном этапе декодирования. Однако контроль может осуществляться и на
разных этапах сборки полипептидной цепи. Более
того, синтез тех белков, которые претерпевают
посттрансляционные модификации или транспортируются к местам своего назначения внутри клетки,
может регулироваться на каждом из этих этапов.
Позднее, когда мы проанализируем эти процессы подробнее, мы увидим, что механизмы регуляции экспрессии генов весьма разнообразны, многочисленны и очень сложны. И хотя многим из них
присущи общие черты, тонкие механизмы регуляции
всегда уникальны для данного гена, определенного
физиологического состояния организма и условий
окружающей среды. Анализ регуляторных механизмов бактериальных систем позволил выявить широкий спектр способов регуляции и координации экспрессии генов. Однако исследование механизма контроля экспрессии генов в клетках эукариот только
начинается, а процессы, ответственные за дифференцировку многоклеточных организмов, пока остаются невыясненными.
3.2. ТРАНСКРИПЦИЯ:
ПЕРЕДАЧА ИНФОРМАЦИИ
О НУКЛЕОТИДНОЙ
ПОСЛЕДОВАТЕЛЬНОСТИ ДНК
НА УРОВЕНЬ РНК
В этом и следующем разделах мы рассмотрим
некоторые аспекты переноса информации о нуклеотидной последовательности ДНК на уровень РНК –
процесса, ответственного за синтез всех типов кле-
118
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
точных РНК как у про-, так и у эукариот. Подавляющее число пионерских работ, в которых изучалась
транскрипция,– природа соответствующих реакций
и их субстраты, ферментативный аппарат, сигнальные нуклеотидные последовательности, определяющие, какие области ДНК должны транскрибироваться, некоторые способы процессинга, превращающего первичные транскрипты в зрелые молекулы
РНК,– было выполнено на прокариотических системах. Параллельное проведение генетических и биохимических экспериментов позволило исследовать
ферменты, участвующие в транскрипции, и механизм самого этого процесса. Предпринимаемые в то
же время усилия по изучению транскрипционного
и регуляторного аппаратов у эукариот были сильно
затруднены и гораздо менее успешны главным
образом из-за того, что компоненты их транскрипционного аппарата – ДНК в форме хроматина и
РНК-полимеразы – были слабо охарактеризованы.
Кроме того, была неизвестна природа транскрипционных единиц, а применение генетических подходов для их определения было невозможно.
Ситуация резко изменилась с появлением методов молекулярного клонирования. Сейчас многие
гены, составляющие различные типы транскрипционных единиц, выделены, секвенированы и даже соответствующим образом модифицированы с
целью исследования их функций. Более того, использование некоторых современных подходов позволило по-новому посмотреть на транскрипционный аппарат самых разных организмов – от дрожжей до человека. Имеются в виду методы введения
ДНК в культуры клеток млекопитающих (гл. 5)
и даже в клетки целого организма животных, применяемые наряду с традиционными методами исследования очищенных транскрипционных систем in vitro.
Одновременно был достигнут прогресс в установлении структуры хроматина и свойств эукариотических РНК-полимераз. В этой главе мы лишь вкратце
рассмотрим системы транскрипции и соответствующие сигналы у эукариот, в первую очередь останавливаясь на их отличии от прокариотических систем.
Подробные данные о структуре генов, механизме
транскрипции и непосредственно связанных с ней
посттранскрипционных событиях, происходящих
при синтезе РНК у эукариот, приведены в гл. 8.
а. Синтез РНК на ДНК-матрице
Двухцепочечная молекула ДНК – это физиологическая матрица для синтеза всех клеточных РНК.
Даже если геном, как у некоторых вирусов, представлен одноцепочечной ДНК, последняя перед
транскрипцией обязательно переходит в двухцепочечную репликативную форму. Транскрибирована
может быть любая из двух цепей геномной ДНК,
однако матрицей при транскрипции отдельного гена
обычно служит только какая-то одна из них (рис.
3.1). Впрочем, в некоторых случаях (примером может служить бактериофаг φХ174) все мРНК транскрибируются с одной и той же цепи. Очень редко
транскрипция идет на обеих цепях в одном и том же
месте, так что образующиеся цепи РНК оказываются комплементарны друг другу; возможно, подобный способ транскрипции имеет особое регуляторное значение.
Нуклеотидными предшественниками для синтеза
РНК являются четыре рибонуклеозид-5'-трифосфата: ATP, GTP, UTP и СТР (рис. 3.2). Многие РНК
содержат модифицированные нуклеотиды, но изменения в основаниях и рибозных остатках происходят
после полимеризации, т.е. посттранскрипционно.
Тем не менее РНК-полимеразы могут использовать
рибонуклеозид-5'-трифосфаты, отличные от указанных четырех, при условии, что модифицированные
основания обладают способностью к спариванию,
сравнимой с таковой для аденина, гуанина, цитозина и урацила.
РНК-полимеразы катализируют реакцию присоединения 3'-ОН-группы нуклеотида, находящегося
на растущем конце цепи, к α-фосфату следующего
рибонуклеозид-5'-трифосфата (рис. 3.3). Многократное повторение этой реакции приводит к постепенному удлинению цепи РНК. Образование каждой
новой фосфодиэфирной связи сопровождается высвобождением неорганического пирофосфата; быстрый гидролиз пирофосфата до неорганического фосфата in vivo делает реакцию образования фосфодиэфирной связи энергетически выгодной.
Транскрипция аналогична репликации в том
смысле, что для ее осуществления также нужна
ДНК-матрица (рис. 3.3). Порядок присоединения
нуклеотидов определяется комплементарным спариванием оснований. Чтобы могло происходить
комплементарное спаривание каждого следующего
нуклеозидтрифосфата с матричным транскрибируемым основанием, спираль ДНК во время транскрипции должна раскручиваться с помощью ДНКполимеразы (рис. 3.4). Растущая цепь РНК остается
связанной с ферментом и спаренной своим растущим концом с участком матричной цепи длиной
20–30 нуклеотидов; остальная часть образовавшейся цепи не связана ни с ферментом, ни с ДНК. По
мере продолжения транскрипции временно разошедшиеся цепи ДНК воссоединяются и восстанавливается исходная дуплексная структура. Таким образом, транскрипция – процесс консервативный, в
котором сохранаяется двойная спираль ДНК, а синтезированная цепь РНК отделяется. В противоположность этому репликация ДНК полуконсервативна, поскольку обе цепи исходного дуплекса распре-
119
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Смысловая цепь
Несмысловая цепь,
или матрица
РНК
А
ДНК фага Т4
РНК копируются только
с одной цепи дуплекса ( φ Х )
Б
РНК копируются с любой
цепи дуплекса,
а иногда с обеих цепей
в одной области (λ)
В
РИС. 3.1.
РНК-транскрипты и соответствующие матричные ДНК.
А. РНК-транскрипты комплементарны и антипараллельны матричной цепи и имеют такую же нуклеотидную последовательность (за исключением того, что
место Т занимает U), как и смысловая цепь. Б. Индивидуальные мРНК обычно закодированы в одной из цепей
дуплексного генома, однако для разных мРНК матрицей могут служить разные цепи (как у бактериофага
Т4). Таким образом, транскрипция, которая всегда осуществляется от 5'- к 3'-концу, может идти в обоих
направлениях. Иногда все транскрипты образуются на
одной цепи генома (как у бактериофага φХ174). В. В тех
редких случаях, когда гены перекрываются, обе цепи
в одной и той же области могут служить матрицами для
молекул РНК, транскрибируемых в противоположных
направлениях.
Аденин
Цитозин
Гуанин
РИС. 3.2.
Четыре наиболее распространенных рибонуклеозид-5'трифосфата: ATP, CTP, GTP и UTP. Рибозилтрифосфатные остатки и соответствующие химические связи во
всех случаях идентичны.
Урацил
120
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Матричная цепь ДНК
Растущая цепь РНК
Направление
матричной
цепи 5'—>3'
РИС. 3.3
Присоединяемый
рибонуклеозидтрифосфат
Рост цепи РНК осуществляется путем последовательного присоединения рибонуклеотидных остатков в направлении 5'–>3'. Последовательность рибонуклеотидов определяется комплементарным спариванием оснований. Присоединение нуклеотида к цепи сопровождается высвобождением одной молекулы пирофосфата. Реакция катализируется РНК-полимеразами.
деляются по двум дочерним спиралям (рис. 2.2).
Другое существенное различие между репликацией
и транскрипцией ДНК состоит в том, что репликация не может начаться без затравки – праймера
(разд. 2.1), а инициация синтеза РНК с помощью
РНК-полимеразы происходит de novo, начинаясь
с рибонуклеозидтрифосфата, соответствующего первому нуклеотиду в цепи РНК.
Наращивание РНК идет в направлении от 5'к 3'-концу вдоль матричной цепи, ориентированной
в направлении 3'–>5', т.е. антипараллельно (рис.
3.3). Несмотря на процессивный характер элонгации
(фермент не отделяется от матрицы в течение всего
раунда транскрипции), ее скорость вдоль матрицы
не постоянна. В некоторых местах фермент делает
остановки; возможно, это происходит там, где в
одноцепочечной ДНК или в самой РНК образуются
Рост цепи
в направлении 5'—>3'
внутрицепочечные дуплексы, мешающие продвижению полимеразы. Такие паузы могут при определенных обстоятельствах приводить к преждевременной терминации транскрипции. Как мы вскоре увидим, сигналами для нормальной терминации и отделения синтезированной РНК и полимеразы от
матрицы являются особые структуры РНК –
шпильки.
Каков механизм однонаправленного движения
РНК-полимеразы вдоль матричной ДНК, остается
неясным. Не знаем мы пока и того, как расплетается
и заплетается вновь во время транскрипции дуплекс
ДНК и почему восстановление этого дуплекса более
выгодно, чем образование дуплекса ДНК-РНК.
Можно лишь отметить, что, поскольку РНК-полимераза одна осуществляет все эти функции in vitro
даже в случае ковалентно замкнутых кольцевых
121
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
РНК-полимераза
Исследования с применением препаратов, ингибирующих РНК-полимеразу, и с ферментами, субъединицы которых были изменены в результате мутации, несколько прояснили роль кор-субъединиц.
β-Субъединица скорее всего участвует в связывании
рибонуклеозидтрифосфатов в реакциях инициации
и элонгации. Комплекс α- и β'-субъединиц (α2β')
участвует в неспецифическом прочном связывании
с ДНК и в специфическом взаимодействии холофермента с промоторами – сайтами, детерминирующими инициацию транскрипции (разд. 3.2.в). Наиболее полно по сравнению со всеми другими субъТаблица 3.1. Субъединицы РНК-полимеразы
Е. coli
Субъединицы
РИС. 3.4.
РНК-полимераза расплетает дуплекс ДНК в том месте,
где происходит транскрипция. В ходе транскрипции
фермент и локально расплетенный участок перемещаются вдоль ДНК и происходит удлинение цепи РНК.
матричных ДНК, все секреты, по-видимому, кроются в самом этом ферменте. Для сравнения вспомним, что ДНК-полимеразы не способны к инициации синтеза новых цепей de novo и что в процессах
расплетания и восстановления дуплексов при репликации двухцепочечной ДНК участвуют геликазы
и топоизомеразы.
б. ДНК-зависимые РНК-полимеразы
У прокариот синтез всех видов РНК – мРНК,
рРНК и тРНК, а также более специализрованных
РНК, участвующих в процессинге РНК (разд. 3.3.в),–
катализируется единственной ДНК-зависимой РНКполимеразой (РНК-праймеры для синтеза ДНК образуются с помощью специальных РНК-полимераз,
называемых праймазами; разд. 2.1.д). Бактериальные РНК-полимеразы – это сложные белки, состоящие из нескольких разных субъединиц. Наиболее
изученный фермент – холофермент РНК-полимераза
Е. coli – содержит пять разных полипептидных субъединиц (табл. 3.1): две α-цепи, одну β- и одну β'-цепи,
σ- и ω-цепи (α2ββ'σω). Альтернативная, сосуществующая с первой форма фермента, называемая
кором, лишена σ-субъединицы.
Число
Мол. масса,
копий в
дальтоны
холоферменте
Альфа (α)
Бета (β)
2
1
36500
150000
Бета прим
1
155000
Сигма (σ)
1
70-80000
Омега (ω)
1
(β')
11000
Функция
Неизвестна
Связывание рибонуклеозидтрифосфатов и полимеризация РНК
Связывание ДНК
Узнавание промотора и инициация
Неизвестна
единицами холофермента изучена роль σ-субъединицы. Кор-фермент, лишенный σ-субъединицы, катализирует большинство реакций, необходимых для
транскрипции ДНК с образованием РНК, а именно
комплементарное копирование матричной цепи, образование фосфодиэфирных связей и терминацию
цепи РНК. Однако он не может инициировать синтез РНК в нужном месте, поскольку не способен
узнавать промоторные сайты (разд. 3.2.в). Точное
связывание и инициация в промоторах происходят
только после добавления к кор-ферменту σ-субъединицы и образования холофермента (рис. 3.5).
Такое поведение можно объяснить, например, тем,
что кор-фермент очень прочно, но неспецифично
связывается с ДНК, а поэтому редко оказывается
в том месте, где находится промотор. И напротив,
холофермент
связывается
с
неспецифическими
участками ДНК непрочно и, последовательно связываясь с разными областями ДНК, находит промотор и прочно связывается с ним. После образования нескольких первых фосфодиэфирных связей
(возможно, от 5 до 10) σ-субъединица отделяется от
инициирующего комплекса, и дальнейшая транскрипция осуществляется с помощью кор-фермента.
Транскрипция непрерывно продолжается до тех пор,
пока фермент не достигнет сайта терминации тран-
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
122
Холофермент
Терминаторная
последовательность
Промотор
Кор-фермент
ДНК
σ
Инициация
Отсоединение
σ-субъединицы
Элонгация
цепи
РНК
Элонгация цепи
до терминаторной
последовательности
Отделение корфермента и РНК
РИС. 3.5.
«Рабочий цикл» σ-субъединицы. Кор-фермент связывается с σ-субъединицей, образуя холофермент, который
прочно связывается с промотором. После запуска
транскрипции σ-субъединица отделяется, а кор-фермент катализирует элонгацию цепи.
скрипции. Итак, σ-субъединица обеспечивает эффективное связывание холофермента с промотором,
а при ее отсоединении полимераза переключается на
элонгацию. σ-Субъединица может снова стимулировать инициацию, специфически связавшись с другой
молекулой РНК-полимеразы.
Имеются данные о том, что способность РНКполимеразы узнавать промотор может изменяться
при связывании с разными σ-субъединицами (рис.
3.6). Так, после заражения Bacillus subtilis определенными бактериофагами или на ранних стадиях споруляции экспрессируются разные σ-субъединицы и
Ранние гены
PЕ
Поздние гены
"Средние" гены
PМ
29
σ
σ33
σ34
σ33 PL
σ34
PL
σ33 + σ34
В. subtilis
σ55
РИС. 3.6.
В. subtilis
кор-фермент
29
σ
Схема, иллюстрирующая участие различных σ-субъединиц в споруляции у В. subtilis. Некоторые σ-субъединицы, в частности σ55, присутствуют и в вегетативных
клетках. В условиях, стимулирующих споруляцию (в
частности, голодание), появляется несколько новых
σ-субъединиц, например σ29, которые и связываются
с кор-ферментом. Образовавшийся холофермент связывается с промоторами специфических генов споруляции, названных здесь «средними» генами. Затем экспрессируются другие специфические σ-субъединицы (в
том числе σ33 и σ34); в комплексе с кор-полимеразой
они инициируют транскрипцию генов, продукты которых необходимы для поздних стадий споруляции.
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
в результате изменяется порядок транскрипции клеточных и вирусных генов. Использует ли РНК-полимераза других прокариот различные σ-субъединицы для регуляции промоторной специфичности,
пока неизвестно.
Не все РНК-полимеразы прокариот представляют собой мультисубъединичные ферменты. РНКполимеразы, кодируемые бактериофагами Т3 и Т7
Е. coli,– это одиночные полипептидные цепи средней
длины (~ 100 кДа). Эти ферменты высокоспецифичны в отношении промоторных сайтов, используемых для транскрипции определенного набора вирусных генов. Такие «упрощенные» ферменты обладают всеми активностями мультисубъединичных
РНК-полимераз. Они катализируют синтез РНК на
ДНК-матрицах и осуществляют правильную терминацию цепей РНК.
в. Транскрипция инициируется
в особых нуклеотидных
последовательностях
Транскрипция инициируется при образовании
стабильного комплекса между холоферментом и
специфической последовательностью, называемой
промотором и располагающейся в начале всех транскрипционных единиц (рис. 3.7). Изучение нуклеотидной последовательности более чем 50 разных
промоторных сайтов прокариот и мутационный
анализ выявили только два консервативных участка,
по-видимому играющих ключевую роль в узнавании и функционировании промотора. Одна из этих
последовательностей состоит из шести или семи
пар оснований и расположена на расстоянии примерно 10 оснований до того нуклеотида, с которого
начинается транскрипция (+1); этот сигнал обычно обозначают как –10-последовательность, или
Прибнов-бокс в честь ее открывателя. Сравнительный анализ –10-последовательностей примерно 50
промоторов прокариот показал, что все они немного отличаются от консенсус-последовательности
ТАТААТ (рис. 3.8). Подчеркнутый Т присутствует
почти во всех промоторах, тогда как по другим
позициям в каждом промоторе может наблюдаться
от одного до нескольких вариантов.
Вторая последовательность, длина которой
обычно равна девяти нуклеотидам, расположена на
расстоянии ~ 35 оснований до сайта инициации
(–35-последовательность) и также встречается в
большинстве промоторов прокариот. Нуклеотидная
последовательность сегмента между –35- и –10участками не является критической, важно лишь
расстояние между этими участками. –35-последовательность участвует в связывании РНК-полимеразы, которое предшествует перемещению фермента
в Прибнов-бокс. Возможно, РНК-полимераза вызывает локальное раскручивание спирали, начиная
этот процесс с Прибнов-бокса, и создает условия
для инициации синтеза РНК (рис. 3.9).
Однако остается открытым вопрос, достаточно
ли простого связывания РНК-полимеразы с промотором для локального расхождения цепей вблизи
сайта инициации синтеза РНК или РНК-полимераза
расплетает спираль в стартовом сайте. Независимо
от механизма образование «открытого» промоторного комплекса позволяет РНК-полимеразе осуществить спаривание первого и второго рибонуклеозидтрифосфатов с матричной цепью и катализировать
образование первой фосфодиэфирной связи.
Различия в эффективности транскрипции индивидуальных генов отчасти зависят от структуры их
промоторов. Как прочность взаимодействия РНКполимеразы с промоторной последовательностью,
так и эффективность образования «открытого» промоторного комплекса определяются конкретными
нуклеотидными последовательностями –35- и –10участков соответственно. Мутации в этих участках
приводят к значительным изменениям способности
многих промоторов обеспечивать инициацию транскрипции (рис. 3.10). В некоторых случаях инициацию транскрипции в малоэффективных промоторах
облегчают вспомогательные белки, связывающиеся
с ДНК вблизи –35-последовательностей (разд.
3.11.в). Суть подобного феномена до конца не
выяснена, но известно, что иногда белки, связывающиеся с –35-последовательностью, увеличивают
вероятность того, что она будет обнаружена РНКполимеразой и свяжется с ней. Связывание белковактиваторов может привести также к изменению
структуры ДНК и тем самым способствовать инициации транскрипции. Изменение топологической
структуры ДНК – особенно увеличение числа отрицательных сверхвитков – также может приводить к
повышению или снижению эффективности некоторых промоторов.
Стартовый
сигнал
–35-последовательность
РИС. 3.7.
Типичный промотор Е. coli.
123
–10-последовательность
Прибнов.
бокс
РНК
124
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Консенсусная
–35-последовательность
Консенсусная
–10-последовательность
РИС. 3.8.
Нуклеотидные последовательности смысловой цепи
ДНК до сайта инициации транскрипции для различных
генов E. соli и бактериофагов. [D.К. Hawley, W.R. McClure, Nucleic Acid Research, 11 (1983), p. 2237.]
Кор-фермент
–35
–10
Старт
Образование комплекса между
"открытым" промотором и ферментом
Инициация синтеза РНК
РИС. З.9.
Связывание холоферментной формы РНКполимеразы (показана схематически) с областью промотора. Считается, что белок
перекрывает область длиной 50 нуклеотидов, начинающуюся немного раньше –35последовательности и кончающуюся внутри
транскрибируемого участка.
Связывание
стимулирует расплетание спирали и транскрипцию.
Цепь РНК
125
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Сайт начала
транскрипции
Область промотора
(замены
оснований)
РИС. 3.10.
Влияние мутаций в –10- и –35-последовательностях
на транскрипцию. В экспериментах использовался промотор генома фага Р22. Все представленные здесь
мутации подавляют транскрипцию. Некоторые мутации
состояли в замене двух оснований. [P. Youderian,
S. Bouvier, M.M. Suskind, Cell, 30 (1982), p. 843.]
г. Терминация транскрипции
и отделение цепей РНК
терминаторы. Оба они имеют некоторые общие
признаки (рис. 3.11). И тот и другой содержат
инвертированные повторы, благодаря чему 3'-концы РНК-транскриптов складываются с образованием шпилек разной длины. Стебли шпилек ρ-независимых терминаторов обычно содержат GC-богатые
участки; один из них находится вблизи основания
стебля, и к нему примыкает участок, состоящий из
четырех-шести уридиловых и одного-двух адениловых остатков. В стебле ρ-зависимых терминаторов,
напротив, содержится лишь несколько GС-пар (а
иногда и не содержится вообще), а уридиновые
3'-хвосты могут отсутствовать.
Последовательности ДНК, являющиеся сигналами остановки транскрипции, называются транскрипционными терминаторами. Обнаружены два типа сигналов терминации – ρ-зависимый и ρ-независимый
РИС. 3.11.
Примеры шпилек в ρ-независимых и ρ-зависимых терминаторах. [В. Lewin, Genes III (New York: Wiley, 1987),
p. 250.]
ρ-Независимый
терминатор
ρ-Независимый
терминатор
ρ-Зависимый
терминатор
126
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Точный механизм ρ-независимой и ρ-зависимой
терминации транскрипции является пока предметом
дискуссий. Наиболее вероятным представляется следующее объяснение ρ-независимой терминации:
РНК-полимераза останавливается после транскрипции инвертированного повтора, потому что шпилечная структура оказывается помехой. В результате
сразу после остановки процесса РНК отделяется от
матричной цепи вблизи U-богатого участка, который относительно слабо спарен с А-богатым участком матрицы. Этим, по-видимому, объясняется то
обстоятельство, что наиболее часто на конце цепи РНК находятся уридиловые или адениловые
остатки.
ρ – это олигомерный белок, прочно связывающийся с РНК и в этом состоянии гидролизующий
АТР до ADP и неорганического фосфата. В одной
из моделей действие ρ-белка объясняется тем, что
он связывается с синтезируемой цепью РНК и пере-
мещается вдоль нее в направлении 5'–>3' к месту
синтеза РНК; необходимая для его перемещения
энергия выделяется при гидролизе АТР (рис. 3.12).
Если ρ-белок наталкивается на образующуюся в
РНК шпильку, он останавливает полимеразу, которая могла бы продолжать транскрипцию. Возможно, для отсоединения РНК от матрицы достаточно
этой ρ-индуцированной остановки, но не исключено,
что диссоциации и отделению способствует сам
ρ-белок.
Терминация транскрипции редко является абсолютно зависимой или абсолютно независимой от
ρ-белка. Некоторые ρ-независимые терминаторы
работают в присутствии ρ более эффективно. А в некоторых условиях так называемые ρ-зависимые терминаторы вызывают терминацию и в отсутствие ρ,
хотя и не столь успешно.
Терминация, как и инициация синтеза РНК, является регулируемым процессом. Существуют бел-
РНК-полимераза
транскрибирует ДНК
ρ-Белок присоединяется
к 5'-концу цепи РНК
ρ-Белок перемещается
по РНК за счет энергии
гидролиза АТР
Полимераза
останавливается
в терминаторе под
влиянием ρ-белка
Терминациятранскрипции
и отделение
полимеразы и РНК
РИС. 3.12.
Влияние ρ-белка на остановку РНК-полимеразы в терминаторе, сопровождающуюся терминацией транскрипции с отделением фермента и синтезированной к этому
моменту РНК. [В. Lewin, Genes III (New York: Wiley,
1987), p. 260.]
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
127
ки, функционирующие как антитерминаторы и предотвращающие терминацию в ρ-независимых терминаторах; известны также другие белки, ингибирующие ρ и тем самым обеспечивающие удлинение цепи
после сигналов терминации. При определенных обстоятельствах молекулы РНК могут образовывать
альтернативные шпилечные структуры на особых
последовательностях определенных участков ДНК.
Одни из таких структур могут приводить к абортивной терминации, а другие – к продолжению
транскрипции. Регулируемая терминация как способ
контроля за образованием мРНК обсуждается в
разд. 3.11.г.
3.3. ПРОЦЕССИНГ РНК
У ПРОКАРИОТ
Первичные транскрипты, образующиеся при
транскрипции прокариотических генов, кодирующих белки, функционируют в качестве мРНК без
последующей модификации или процессинга. Действительно, трансляция мРНК часто начинается даже
до завершения синтеза 3'-конца транскрипта (разд.
3.7.а). Совсем иная ситуация наблюдается для молекул рРНК и тРНК. В этом случае кластеры рРНКили тРНК-генов или даже перемежающиеся участки
этих генов часто транскрибируются с образованием
единой цепи РНК. И хотя транскрипция этих генов
всегда начинается на определенных промоторах и
заканчивается на определенных терминаторах, для
образования зрелых функциональных форм должны
произойти специфическое надрезание первичных
РНК-транскриптов и модификация. Подобные молекулярные события называют общим термином
посттранскрипционные модификации или просто процессинг РНК. Механизмы процессинга рРНК и
тРНК и ферменты, с помощью которых он осуществляется, наиболее полно изучены у Е. coli, и для
иллюстрации особенностей посттранскрипционного
процессинга РНК мы используем эту систему. Аналогичные модификации эукариотических РНК обсуждаются в гл. 8; в этом случае помимо процессинга рРНК и тРНК используются более сложные
системы созревания транскриптов с образованием
мРНК.
РИС. 3.13.
Локализация на хромосомной карте E. coli семи транскрипционных единиц рРНК.
довательностей для 5S-, 16S- и 23S-pPHK. Транскрипция в этой области осуществляется в направлении 16S –> 23S –> 5S. Помимо этих трех последовательностей, кодирующих рРНК, транскрипты содержат вставки разной длины (спейсеры) и одну или
более копий тРНК-генов (рис. 3.14). Спейсеры могут
находиться перед последовательностями для рРНК,
между ними и после них, а тРНК-гены обычно
лежат в пределах вкрапленных или 3'-концевых
спейсерных сегментов. Для образования функционально зрелых молекул РНК должен произойти
процессинг таких транскриптов. До процессинга или
во время него происходит модификация специфических оснований в спейсерах, а также в рРНК- и
тРНК-генах.
а. Группы генов,
кодирующих рРНК и тРНК
В геноме Е. coli идентифицированы и картированы семь дискретных транскрипционных единиц,
кодирующих рРНК; на рис. 3.13 они обозначены
r r n A – Н . Каждая транскрипционная единица – это
молекула РНК, которая состоит из ~ 5000 нуклеотидов и содержит по одной копии кодирующих после-
РИС. 3.14.
Схематическое представление трех типичных транскрипционных единиц рРНК E. coli. Указаны кодирующие
участки для 5S-, 16S- и 23S-pPHK, молекул тРНК
и спейсерные сегменты.
128
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
б. Разрезание рРНК-тРНКкотранскриптов
Начальное расщепление первичных транскриптов на фрагменты, содержащие либо тРНК, либо
16S-, 23S- или 5S-рРНК-последовательности, осуществляет эндонуклеаза РНКаза III. Ее мишенями
служат короткие дуплексы РНК, образующиеся при
внутримолекулярном спаривании оснований в последовательностях, фланкирующих каждый из
рРНК-сегментов (рис. 3.15). Например, комплементарные участки в спейсерных областях, фланкирующих последовательность 16S-pPHK, образуют стебель шпильки, в петле которой находится последовательность 16S-pPHK. Аналогичные шпильки образуют и последовательности 23S- и 5S-pPHK.
РНКаза III вносит разрывы в двухцепочечный стебель, в результате образуется цепь РНК, содержащая последовательность той или иной рРНК, фланкированную короткими спейсерными участками с 5'фосфатным и 3'-гидроксильным концами. Затем
лишние нуклеотиды спейсерных последовательностей удаляются, возможно с помощью той же самой
РНК-экзонуклеазы, которая катализирует и последние этапы процессинга тРНК (разд. 3.3.в). В принципе для того, чтобы произошло ферментативное
расщепление, должны быть транскрибированы толь-
ко те нуклеотидные последовательности, которые
образуют шпильки. Однако процессинг происходит
лишь после завершения синтеза всего первичного
транскрипта, поскольку, по-видимому, для правильной укладки целого РНК-транскрипта, который и
распознается эндонуклеазой III, необходимы рибосомные или какие-либо другие белки. Процессинг
тРНК-сегментов, выщепляющихся из мультигенных
транскриптов, осуществляется так же, как и процессинг тРНК из транскрипционных единиц одиночных
генов (разд. 3.3.в).
в. Образование зрелых тРНК
из более крупных транскриптов
Несмотря на то что некоторые кодирующие
тРНК гены находятся внутри транскрипционных
единиц рРНК и экспрессируются совместно с генами
рРНК, основная часть тРНК-генов представлена
одиночными генами или объединена в кластеры.
Одни кластеры содержат множественные повторы
одних и тех же генов (например, три идентичные
копии гена тРНКТуг), другие – различные и неродственные тРНК-гены (рис. 3.16). В некоторых случаях
каждый кластер транскрибируется как одна большая молекула РНК, которая подвергается процессингу с последовательным выщеплением зрелых
16S-рРНК,
~ 1600 иуклеотидов
23S-pPHK,
~ 2900 нуклеотидов
РНКаза III
РНКаза III
РНКаза III
РНКаза III
РИС. 3.15.
Сайты расщепления для РНКазы III
в предшественниках рРНК. Эти сайты
находятся в стебле, образуемом при
внутримолекулярном спаривании оснований спейсерных участков, фланкирующих 16S- и 23S-рРНК-последовательности. [В. Lewin, Genes III
(New York: Wiley, 1987), p. 453.]
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Промотор
129
Терминатор
РРР
Первичный
транскрипт
Промотор
Терминатор
РРР
РИС. 3.16.
Типичные кластеры генов тРНК E. coli и их первичные
транскрипты.
тРНК-фрагментов (рис. 3.17). Для образования зрелой функциональной тРНК, по-видимому, должны
произойти специфическая модификация оснований
и присоединение одного, двух или всех трех нуклеотидов 3'-ССА-конца.
Независимо от того, содержит ли первичный
транскрипт одну или более тРНК-последовательностей или эти последовательности внедрены в спейсерные участки рРНК, 5'-концы всех тРНК образуются при участии одной эндонуклеазы, называемой
РНКазой Р. По-видимому, РНКаза Р узнает характерную свернутую структуру тРНК в полинуклеотиде-предшественнике и отщепляет лидерную или
спейсерную последовательности, расположенные перед 5'-концом зрелой последовательности тРНК.
3'-концы тРНК образуются с помощью нескольких
активностей. До сих пор неидентифицированная
эндонуклеаза расщепляет предшественник в том месте шпильки, где находится 3'-конец зрелой тРНК,
а затем другая эндонуклеаза, РНКаза D, завершает
образование правильного 3'-конца. В некоторых
случаях экзонуклеазное расщепление прекращается
точно у 3'-ССА-конца зрелой тРНК (рис. 3.17), а в
других случаях под действием экзонуклеазы образуется конец, служащий затравкой, к которому тРНКнуклеотидилтрансфераза добавляет один или более
инвариантных концевых нуклеотидов (С и/или А).
Отличительной особенностью РНКазы Р является то, что сайт расщепления для нее формируется
в результате правильной укладки молекулы тРНК.
Изменения в нуклеотидной последовательности, не
приводящие к нарушению этой укладки, не сказываются и на процессинге 5'-конца. Другим необычным
свойством РНКазы Р является то, что она состоит
из белка и РНК. Эта РНК имеет специфическую
последовательность из 377 нуклеотидов и сама
транскрибируется РНК-полимеразой с гена чуть
большего размера и затем подвергается процессингу до размера зрелой молекулы. Удивительной особенностью этой РНК оказалось то, что она одна
может катализировать такую же эндонуклеазную
реакцию, что и целый рибонуклеопротеин; белок же
не обладает самостоятельной эндонуклеазной активностью. Таким образом, эндонуклеазная активность может быть присуща самой РНК, а белок,
по-видимому, необходим для сохранения структуры
РНК в максимально активной конфигурации.
Зрелые тРНК не только имеют характерную
конформацию, но и содержат модифицированные
нуклеотиды (рис. 3.18). Многие из таких модификаций оказываются существенными для выполнения
некоторых физиологических функций тРНК. Сегодня охарактеризованы лишь немногие из целой армии ферментов, катализирующих огромное количество реакций модификации. Однако ясно, что моди-
130
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Три остатка,
отщепляемые
РНКазой D
3'-конецтРНК
РНКаза Р отщепляет
лидерную последовательность
длиной 41 нуклеотид
с образованием 5'-конца тРНК
Модификации оснований
после транскрипции
РИС. 3.17.
Различные этапы образования зрелой тРНК из предшественника (на примере тРНК Туr Е. соli).
фикации происходят в основном на стадии РНКпредшественника и в полностью процессированной
тРНК. Такие модифицирующие ферменты представляют особый интерес благодаря своей необычной
специфичности в отношении определенных последовательностей: например, только отдельные урациловые остатки превращаются в тиоурацил, метилируются до тимина или восстанавливаются до дигидроурацила. Еще более загадочным представляется
образование псевдоуридилата при модификации
обычной связи между урацилом и рибозой (рис.
1.21).
3.4. ГЕНЕТИЧЕСКИЙ КОД
Последовательность аминокислот в белках определяется порядком расположения дезоксинуклеотидов в генах, кодирующих белки, точнее – последовательностью рибонуклеотидов в мРНК-транскриптах. Информационная связь между нуклеотидными
Y - Пиримидин
R - часто пурин
DU - часто дигидроуридин
* - модифицированное основание
Т - тимидин
ψ - псевдоуридин
РИС. 3.18.
Схематическое изображение тРНК в форме клеверного
листа. В определенных позициях у всех тРНК находятся
модифицированные основания.
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
и аминокислотными последовательностями осуществляется с помощью генетического кода. Для составления генетического словаря было проведено
множество специальных генетических и биохимических экспериментов. Он включает также и знаки
препинания – начало и конец участков, кодирующих
белки. За исключением незначительных вариаций
в использовании нескольких нуклеотидов для кодирования особых аминокислот у митохондрий и некоторых инфузорий, генетический словарь универсален, т.е. конкретная последовательность нуклеотидов задает одинаковую для всех живых организмов
аминокислотную последовательность.
Наличие подобной системы кодирования подразумевает существование некоего механизма для перевода информации с языка нуклеотидов на язык
аминокислот. Как и следовало ожидать, этот механизм и реакции, осуществляющие перевод (трансляцию), очень сложны. Несмотря на различия между
про- и эукариотами как в том, что касается структуры мРНК (разд. 3.8.а), так и в физическом взаимоотношении генов и аппарата трансляции, оба типа
организмов используют весьма сходные механизмы
для расшифровки генетических посланий.
В этом разделе описываются свойства генетического кода. Аппарат трансляции и процесс сборки
белка мы обсудим в разд. 3.5-3.8.
РИС. 3.19.
Изучение мутаций, сдвигающих рамку считывания, показало, что кодоны состоят из трех нуклеотидов. Использовались мутагены (в частности, профлавин), которые индуцировали делеции или вставки одного или двух
оснований. Образующиеся мутанты синтезировали неактивные или укороченные полипептиды, поскольку
сдвиг рамки приводит к появлению кодонов, детерминирующих неправильные аминокислоты, или стоп-кодона. Рекомбинация между двумя мутантами, один из
которых содержит делецию, а другой в этой же или
близкой позиции - вставку (например, –1 х +1 или
–2 х +2), может привести к восстановлению функционального гена, если несколько концевых, находя-
131
а. Аминокислотная
последовательность белков
соответствует нуклеотидной
последовательности
кодирующих их генов
Предположение о коллинеарности нуклеотидных
и аминокислотных последовательностей было высказано в числе первых в дискуссии о природе
генетического кода. Догадки такого рода возникли
после того, как было показано, что многие мутации
проявляются в замене одной-единственной аминокислоты в белках бактерий, растений или животных.
Но гипотеза коллинеарности оставалась неподтвержденной до тех пор, пока не были проведены
тщательные генетические и биохимические исследования хорошо охарактеризованных генно-белковых
систем. Например, было показано, что относительное положение аминокислотных замен в α-субъединице триптофансинтетазы Е. coli согласуется с относительной локализацией на карте соответствующих
мутаций в trpA-гене этого микроорганизма. Однако
выделить и охарактеризовать мутантную ДНК в то
время не удалось, поэтому нельзя было установить
соответствие между нуклеотидными последовательностями и аминокислотными.
Теоретический анализ привел к предположению,
что наиболее подходящей по размеру для генетической кодирующей единицы, или кодона, является
последовательность из трех нуклеотидов. В основе
щихся за рамкой считывания кодонов приходятся на
несущественную часть полипептида. Рекомбинация между мутантами, которые оба имеют по одной вставке
(+1 х +1) или по делеции из двух оснований
(–2 х –2), не способна исправить мутацию. Напротив,
рекомбинация между генами, имеющими в сумме три
близко расположенных вставочных основания (например, +1 х +2) или три близко расположенных делегированных основания (например, –1 х –2), может
привести к восстановлению функциональных генов,
поскольку за этими измененными участками восстанавливается нормальная рамка считывания.
132
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
этого вывода лежали три соображения. Во-первых,
четыре нуклеотида, взятые по одному, могут кодировать только четыре разные аминокислоты. Сочетания из двух нуклеотидов могут кодировать толь2
ко 4 , или 16 аминокислот, а это меньше, чем те
20 аминокислот, которые, как было известно, присутствуют в белках. И только совокупности трех
3
нуклеотидов дают 64 возможных кодона (4 ), т.е.
число, более чем достаточное для кодирования 20
разных аминокислот. Генетические эксперименты,
выполненные на мутантах с делециями или вставками длиной один, два или три нуклеотида в генах,
кодирующих белки, позволили доказать, что наиболее подходящий размер для кодона – три нуклеотида (рис. 3.19). Более того, из этих исследований был
сделан вывод, что нуклеотидная последовательность считывается расположенными один за другим
триплетами с фиксированной точки. Все эти выводы
наряду с данными о том, что полипептидные цепи
синтезируются последовательно путем соединения
аминогруппы одной аминокислоты с карбоксильной
группой другой, послужили краеугольным камнем
в расшифровке генетического кода.
б. Соответствие между
аминокислотами и их кодонами
Одним из загадочных моментов кодирования
было отсутствие структурной комплементарности
между нуклеиновыми кислотами, с одной стороны,
и аминокислотными цепочками – с другой. Выход из
этого концептуального тупика – ответ на вопрос, как
аминокислоты спариваются с соответствующими
кодонами,– был найден, когда появилась идея о существовании адаптора. Согласно этой идее, аминокислоты сначала связываются с молекулами РНК,
а затем такие гибриды выстраиваются вдоль мРНК,
соединяясь с ней путем комплементарного спаривания нескольких оснований в адапторной молекуле
РНК с соответствующим кодоном в мРНК (рис.
3.20). Адапторная гипотеза получила строгое экспериментальное подтверждение после того, как были
обнаружены тРНК и ферменты, ответственные за
связывание аминокислот и тРНК, и показано, что
присоединенные к тРНК аминокислоты являются
прямыми предшественниками при сборке полипептида.
Если тРНК – это адапторы, то каждая аминокислота должна присоединяться только к специфической тРНК, а каждая тРНК – спариваться только
с одним, соответствующим ей кодоном. Правильность первого из этих положений была доказана
с открытием особых ферментов – аминоацил-тРНКсинтетаз, каждый из которых связывает одну-единственную аминокислоту с одной или несколькими
родственными тРНК (рис. 3.21). Эти ферменты и катализируемые ими реакции более детально будут
рассмотрены в разд. 3.5.а. Здесь достаточно сказать, что связывание аминокислот с молекулами
тРНК – это первый шаг в процессе расшифровки.
Правильность второго положения адапторной гипотезы – о том, что тРНК сама определяет место своей
аминокислоты в полипептидной цепи – была подтверждена с помощью простого эксперимента. Одна
из аминокислот, будучи связанной с соответствующей тРНК, была химически превращена в другую.
После включения этой модифицированной аминокислоты в белок in vitro была установлена ее локализация в белковой цепи (рис. 3.22). Оказалось, что
после превращения цистеинил-тРНКCys в аланилтPHKCys остаток аланина, связанный с тРНКСуs,
обнаруживается в тех сайтах белковой цепи, которые обычно занимает цистеин, а не в сайтах, где
обычно находится аланин. Стало ясно, что именно
тРНК с присоединенной к ней аминокислотой, а не
сама аминокислота определяет, с каким кодоном
должно произойти спаривание.
в. Расшифровка генетического кода
Предпосылками для расшифровки кода послужили два открытия. Во-первых, было установлено,
что мРНК – это информационный посредник между
генами и белками. Во-вторых, обнаружилось, что
мРНК, введенная в бактериальные экстракты, транслируется с образованием соответствующих белков.
Прорыв в этой области произошел, когда с помощью экстрактов из клеток Е. coli была осуществлена трансляция синтетических РНК-полиуридилата (poly U), полиаденилата (poly А) и полицитидила-
РИС. 3.20.
тРНК-адапторы
Антикодон
Антикодон
мРНК
Кодон
Кодон
Адапторная гипотеза. Аминокислоты
присоединяются к специфическим адапторным РНК (тРНК), которые затем
выстраиваются вдоль мРНК благодаря
комплементарному спариванию между
кодонами мРНК и антикодонами адаптора.
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
133
РИС. 3.21.
Каждая аминоацил-тРНК-синтетаза присоединяет специфическую аминокислоту к одной или нескольким родственным тРНК.
Цистеинил-тРНКСуs
Синтез белка
Восстановительное десульфирование
Аланил-тРНК Cys
Синтез белка
РИС. 3.22.
Превращение цистеинил-тРНКСуs в аланил-тРНКСуs приводит к синтезу полипептида, в котором аланин занимает позиции, отвечающие цистеиновому кодону UGU. Эти остатки аланина обозначены черными кружками, помещенными
в треугольники.
134
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
та (poly С) – с образованием полифенилаланина, полилизина и полипролина соответственно. Это привело к заключению, что триплеты, состоящие только из U, А и С, кодируют соответственно фенилаланин, лизин и пролин. Затем были проделаны эксперименты с применением смешанных полимеров с
варьирующим соотношением двух и трех нуклеотидов; в результате был определен состав кодонов
(табл. 3.2). Однако эти данные позволили установить лишь нуклеотидный состав кодонов, но не
порядок следования нуклеотидов в них.
Все кодоны были в конце концов идентифицированы при помощи следующих двух экспериментов.
В экспериментах первого типа сравнивали аминокислотную последовательность полипептидов, полученных in vitro с использованием синтетических
мРНК, содержащих определенные повторы из двух
или трех нуклеотидов (рис. 3.23 и табл. 3.3). В экспериментах другого типа определяли, какая именно из
аминоацил-тРНК связывается с рибосомами в присутствии каждого из возможных тринуклеотидов
(рис. 3.24). Эти эксперименты позволили составить
непротиворечивый словарь, в котором 61 трехнуклеотидный кодон соответствует 20 аминокислотам,
а три кодона – окончанию кодирующей последовательности (рис. 3.25).
В коде заложена некая неоднозначность, которая
связана с точкой начала трансляции, а не с соответствием кодон-аминокислота. Эта неоднозначность
обусловлена наличием альтернативных наборов
триплетов, или рамок считывания, для любой полинуклеотидной последовательности (рис. 3.26). Большинство прокариотических генов транслируется при
одной непрерывной рамке считывания; при альтернативных рамках на каждые 20 нуклеотидов приходится в среднем по одному терминирующему кодону.
В экспериментах по расшифровке кода, описанных выше, синтетические полинуклеотиды транслировались в условиях, не требующих точной инициации. Однако in vivo и в соответствующих условиях
Полимер, состоящий из повторяющихся динуклеотидов
Полимер, состоящий из повторяющихся тринуклеотидов
Полимер, состоящий из четырех повторяющихся нуклеотидов
РИС. 3.23.
Некоторые синтетические мРНК, кодирующие определенные полипептиды. Синтез этих специфических полипептидов может осуществляться в клеточных экстрактах,
которые катализируют синтез белков. Заметим, что
аминокислотный состав полипептидного продукта зависит от того, какая из трех возможных комбинаций
оснований в роlу(UАС) n реализуется: UAC, ACU или
CUA.
in vitro инициация происходит только с правильной
рамкой считывания. Однозначность прочтения белок-кодирующей последовательности обеспечивается тем, что трансляция мРНК начинается только со
Таблица 3.2. Кодирующие свойства случайных сополимеров, состоящих из U (0,76) и G (0,24)
в различных комбинациях
Триплет
UUU
UUG
UGU
GUU
UGG
GUG
GGU
GGG
Расчетная частота
триплета
0,44
0,14
0,14
0,14
0,044
0,044
0,044
0,014
Относительная
частота
100
32
32
32
10
10
10
3
Аминокислота
Фенилаланин
Валин
Лейцин
Цистеин
Триптофан
Глицин
Относительная
встречаемость
в полипептидах
Возможный состав
кодона
100
37
36
35
14
3U
2U1G
2U1G
2U1G
1U2G
12
1U2G
135
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
leu-тРНК
phe-тРНК
ile-тРНК
met-тРНК
Контроль
(нет тринуклеотидов)
val-тРНК
Ни одна из аминоацил-тРНК
ser-тРНК
glu-тРНК
рrо-тРНК
cys-тРНК
lys-тРНК
Первая
позиция
(5')
Вторая
позиция
Третья
позиция
(3')
РИС. 3.24.
Идентификация кодонов, основанная на изучении связывания специфических аминоацил-тРНК с рибосомами в присутствии синтетических тринуклеотидов. Рибосомы и необходимые растворимые факторы инкубировали с определенными тринуклеотидами и смесью аминоацил-тРНК, в которой радиоактивно меченной была
только одна аминоацильная единица. С каждым из
комплексов рибосома-тринуклеотид связывалась только одна специфическая меченая аминоацил-тРНК (например, с комплексом рибосома-UCA связывалась радиоактивно меченная пролил-тРНК).
РИС. 3.25.
Генетический код. Верхняя схема построена так, что мы
можем идентифицировать аминокислоту, кодируемую
тем или иным триплетом. Так, триплет CAG можно
расшифровать, найдя точку пересечения С из левой
колонки, А - из верхнего ряда и G - из правой колонки.
Нижняя схема показывает число и состав кодонов,
детерминирующих каждую из аминокислот.
136
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Рамка считывания А
Рамка считывания В
Рамка считывания С
РИС. 3.26.
Нуклеотидная последовательность может
ваться с помощью одной из трех рамок
(трансляция осуществляется в направлении
ва направо). В приведенном примере рамки
транслиросчитывания
5'–>3', слесчитывания
В и С прерываются стоп-кодонами. «Открытой» является
только рамка считывания А, начинающаяся со стартового кодона AUG.
специфического триплета – AUG, и далее расшифровывается каждый последующий триплет в направлении от 5'-конца молекулы мРНК к 3'-концу. Например, кодирующая последовательность, приведенная
на рис. 3.27, транслируется начиная с AUG-кодона,
находящегося вблизи 5'-конца мРНК, по направлению к 3'-концу, где и заканчивается на одном из
трех терминирующих кодонов. Позднее был разработан метод быстрого секвенирования нуклеиновых
кислот и белков, который позволил проверить систему кодирования непосредственно, путем сравне-
ния последовательностей ДНК, РНК и кодируемых
ими белков. Сравнительные исследования подтвердили также и то, что кодирующие последовательности действительно читаются от 5'- к 3'-концу
мРНК.
Таблица 3.3. Включение аминокислот
в полипептидную цепь при использовании
в качестве матрицы синтетических
полинуклеотидов с определенными повторами1)
Повторяющаяся
последовательность
Кодоны
Включаемые
аминокислоты
UC
АG
UG
АС
UUC
AAG
UUG
САА
GUA
UAC
AUC
GAU
UCU-CUC
Ser-Leu
Arg-Glu
Cys-Val
Thr-His
UUC; UCU; CUU
AAG; AGA; GAA
UUG; UGU; GUU
САА; ААС; АСА
GUA; UAG; AGU
UAC; ACU; CUA
AUC; UCA; CAU
GAU; AUG; UGA
Phe; Ser; Leu
Lys; Arg; Glu
Leu; Cys; Val
Gln; Thr; Asp
Val; Ser
Tyr; Thr; Leu
Ile; Ser; His
Asp; Met
UAUC
GAUA
UUAC
GUAA
AGA-GAG
UGU-GUG
АСА-САС
UAU-CUA-UCU-AUC
GAU-AGA-UAG-AUA
UUA-CUU-ACU-
-UAC
GUA-AGU-AAG-
Tyr-Leu-Ser-Ile
Нет
Leu-Thr-Tyr
Нет
-UAA
1)
Н.G. Khorana et. al., Cold Spring Harbor Symp. Quant. Biol.,
31, 39 (1966). Черточки разделяют кодоны в одной и той же рамке
считывания, а точки с запятой в разных рамках.
г. Избыточность генетического кода
Удивительной особенностью кода оказалось то,
что все аминокислоты, кроме двух, кодируются
более чем одним кодоном. Эти две составляющие
исключение аминокислоты, метионин и триптофан,
встречаются в белках достаточно редко. Наибольшее число кодонов имеют серин и лейцин, которыми белки изобилуют. Такие достаточно часто встречающиеся аминокислоты, как цистеин, аланин, глицин, валин, а также дикарбоновые кислоты и их
амиды, кодируются двумя-четырьмя кодонами
каждая. Из-за такой избыточности разные нуклеотидные последовательности могут при трансляции
давать одну и ту же аминокислотную последовательность (рис. 3.28). Итак, если мы знаем нуклеотидную последовательность, то можем однозначно
определить последовательность белка, обратное же
проделать невозможно.
Сигналом для остановки синтеза белка служит
любой из трех кодонов: UAA, UAG или UGA.
Кодон AUG выполняет двойную функцию: он детерминирует аминокислоту метионин и в определенных последовательностях обозначает начало сегмента, кодирующего белок.
Избыточность кода имеет одну интересную особенность: наибольшее число вариаций в кодонах,
детерминирующих данную аминокислоту, приходится на третью позицию (3'-конец триплета). Например, аминокислоты глицин, валин, пролин, аланин и треонин кодируются четырьмя кодонами
каждая, и в каждом случае эти четыре кодона
различаются только нуклеотидами в третьей позиции (рис. 3.25). Если какая-то аминокислота кодируется двумя кодонами, то последние различаются
только пуринами или пиримидинами, находящимися в третьей позиции. И только кодоны для лейцина,
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
РИС. 3.27.
137
Продукт трансляции
Кодирующая последовательность начинается с кодона
AUG и заканчивается терминаторным (стоп) кодоном.
Она фланкируется 5'- (5'-лидерная последовательность)
и 3'- (3'-трейлерная последовательность) нетранслируемыми участками.
серина и аргинина различаются нуклеотидами, находящимися в первой, второй или обеих позициях.
Поэтому мутации, приводящие к заменам нуклеотидов в третьей позиции, часто не сопровождаются
изменением аминокислотной последовательности.
Кроме того, код устроен так, что при замене нуклеотидов даже в первой или второй позиции некоторых
кодонов в полипептид включается структурно родственная аминокислота, сводя тем самым к минимуму нарушения во вторичной структуре белка. Кодоны для гидрофобных аминокислот, например фенилаланина, лейцина, изолейцина и валина, различаются только одним нуклеотидом. Аналогичная ситуация наблюдается и для кодонов серина и треонина или аланина и глицина.
д. Универсальность
генетического кода
РИС. 3.28.
Две разные нуклеотидные последовательности могут
кодировать один и тот же полипептид.
По-видимому, все прокариоты, а также большинство эукариот (по крайней мере в том, что
касается ядерного генетического материала) пользуются одним и тем же словарем кодонов независимо от того, представлен ли их геном ДНК или РНК.
В этом смысле нередко говорят, что код универсален. Тем не менее частота использования кодоновсинонимов варьирует как на уровне организмов, так
и на уровне мРНК. Если действительно какие-то
кодоны используются в большинстве кодирующих
белки последовательностей чаще, чем другие, то это
должно найти отражение в относительном содержании в клетке различных тРНК, расшифровывающих
кодоны-синонимы. Так, если кодон AGA встречается в мРНК какого-либо организма сравнительно
редко, то и содержание тРНК A r g , расшифровывающей AGA, должно быть невелико. В некоторых
случаях выбор кодонов для конкретной кодирующей последовательности определяется задачами, не
связанными с их трансляцией. Например, определенное взаимное расположение кодонов может благоприятствовать образованию специфической вторичной структуры мРНК; таким образом, присутствие конкретных кодонов может влиять на готовность мРНК к трансляции и тем самым играть
регуляторную роль. В некоторых случаях экспериментальная замена существующих кодонов их синонимами приводит к изменению стабильности мРНК
при полном сохранении ее способности к правильной трансляции.
Редкие исключения в стандартном словаре кодонов обнаружены у инфузорий и в митохондриальных генах. Например, в митохондриях млекопитающих кодон UGA читается как триптофан и митохондриальная ДНК кодирует тРНК Тrр , чей антикодон UCA спаривается с UGA почти так же прочно,
как с нормальным триптофановым кодоном UGG.
В митохондриях млекопитающих кодоны AGA и
AGG прочитываются как сигналы терминации.
AUU, AUC, AUA и AUG служат инициирующими
кодонами, a AUA кодирует метионин вместо изолейцина. В митохондриях дрожжей триплеты CUU,
CUC, CUA и CUG кодируют треонин, а не лейцин.
138
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
3.5. АППАРАТ ТРАНСЛЯЦИИ
Основными участниками процесса считывания
информации, закодированной в последовательности
мРНК,
являются
аминоацил-тРНК-синтетазы,
тРНК, рибосомы, белки, связанные с рибосомами,
и некоторые другие белки. Они ответственны за
инициацию, элонгацию и терминацию сборки полипептида. В этом разделе мы опишем свойства каждого из перечисленных компонентов, а в следующем
обсудим, как они функционируют на разных этапах
процесса трансляции.
а. Присоединение аминокислот
к «родственным» тРНК
Функционирование тРНК при трансляции сводится к двум уникальным процессам. Первый из них
состоит в присоединении аминокислоты к 3'-концу
родственной тРНК с помощью специфической аминоацил-тРНК-синтетазы, второй – в специфическом
связывании аминоацил-тРНК с соответствующим
кодоном мРНК, находящейся в комплексе с рибосомой. Ключевой особенностью обеих реакций является их специфичность, поскольку сбои в образовании аминоацил-тРНК или связывании аминоацилтРНК с соответствующим кодоном приведут к
ошибкам в экспрессии генов. Поэтому очень важно
понять природу такой специфичности, механизм ее
обеспечения и последствия нарушений точности на
этих двух этапах трансляции.
Основные особенности структуры тРНК. В любой клетке присутствует очень много разных тРНК.
Молекула тРНК состоит обычно из 75–85 нуклеотидов и содержит уникальный тринуклеотид, который определяет, какую аминокислоту эта тРНК
присоединяет и с каким кодоном она может спариться. На основании данных о нуклеотидной последовательности более чем 150 отдельных видов
тРНК, выделенных из клеток про- и эукариот, были
построены компьютерные модели внутримолекулярного комплементарного спаривания оснований
в молекуле тРНК. Был сделан вывод, что практически все тРНК, независимо от их нуклеотидной
последовательности, обладают характерной вторичной структурой, которую называют структурой
«клеверного листа» из-за наличия в ней трех шпилек
(рис. 3.29). Реальность предсказанной структуры
была подтверждена данными о разной химической
чувствительности оснований, одни из которых спарены, а другие нет (последние образуют так называемые петли).
Большинство молекул тРНК, имеющих форму
клеверного листа, содержат четыре области, каждая
из которых обладает инвариантными свойствами
независимо от аминокислотной специфичности
тРНК. 1. На 3'-конце молекулы всегда находятся
четыре неспаренных нуклеотида, причем три из
них – это обязательно ССА. 5'- и 3'-концы цепи РНК
образуют акцепторный стебель. Цепи удерживаются вместе благодаря комплементарному спариванию семи нуклеотидов 5'-конца с семью нуклеотидами, находящимися вблизи 3'-конца. 2. У всех молекул имеется шпилька TψC, обозначаемая так потому, что она содержит два необычных остатка: риботимидин (Т) и псевдоуридин (ψ). Шпилька состоит
из двухцепочечного стебля из пяти спаренных оснований, включая пару G-C, и петли длиной семь
нуклеотидов. Тринуклеотид ТψС всегда расположен
в одном и том же месте петли. 3. В антикодоновой
шпильке стебель всегда представлен семью спаренными основаниями. Триплет, комплементарный
родственному кодону,– антикодон – находится в петле, состоящей из семи нуклеотидов. С 5'-конца
антикодон фланкируют инвариантный остаток урацила и модифицированный цитозин, а к его 3'-концу
примыкает модифицированный пурин, как правило
аденин. 4. Еще одна шпилька состоит из стебля
длиной три-четыре пары нуклеотидов и петли варьирующего размера, часто содержащей урацил в восстановленной форме – дигидроурацил (DU).
Наиболее сильно варьируют нуклеотидные последовательности стеблей, число нуклеотидов между антикодоновым стеблем и стеблем ТψС (вариабельная петля), а также размер петли и локализация
остатков дигидроурацила в DU-петле.
Рентгеноструктурный анализ некоторых молекул
тРНК позволил выявить их характерную четвертичную структуру (рис. 3.29, Б–Г). Эта структура более
компактна, чем структура «клеверного листа». Она
образуется благодаря внутримолекулярным взаимодействиям, сближающим DU- и ТψС-шпильки.
В результате молекула тРНК выглядит так, как
будто она состоит из двух взаимно перпендикулярных частей – в одной из них находится акцепторный
участок, в другой – антикодон. Из-за такого общего
вида молекулы структура получила название L-конфигурации. L-структура представляется более адекватной, чем «клеверный лист», особенно если учесть,
что тРНК играет роль адаптора при взаимодействии кодона и антикодона на рибосоме.
Обычно акцепторами для одной и той же аминокислоты служат несколько разных тРНК (изоакцепторные тРНК) (рис. 3.30), имеющих разные антикодоны, что позволяет им спариваться с кодонамисинонимами. Отчасти этим объясняется и вырожденность кода, т.е. способность разных антикодонов детерминировать одну и ту же аминокислоту.
Этерификация молекул тРНК. Для выполнения
функции адаптора в процессе трансляции мРНК
тРНК должна связаться с аминокислотой, соответствующей своему антикодону. Это происходит в ре-
139
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
TψC-стебель
OH
Акцепторный
конец
ТψС-петля
Акцепторный
стебель
TψCстебель
DU-петля
Акцепторный стебель
D-петля
ТψС-петля
Вариабельная
петля
3'-акцепторный
конец
D-стебель
Антикодоновый
стебель
Вариабельная
петля
Антикодон
Антикодоновый
стебель
Б
Антикодоновая
петля
А
Антикодон
В
РИС. 3.29.
Типичная эукариотическая тРНК: дрожжевая тРНК P h e . А.
Развернутая структура, имеющая форму клеверного
листа. Б. Свернутый «клеверный лист»; рибозофосфатный остов изображен в виде непрерывной ленты, а водородные связи - в виде стержней. В и Г - проволочная
и пространственная модели свернутого «клеверного лис-
Г
та» соответственно. Структура тРНК на рис. Г повернута
относительно структуры на рис. Б на 180°. Антикодон во
всех случаях находится внизу структуры. [Рис. Б, В
и Г любезно предоставлены S.M. Kim. См.: S.M. Kim et
al., Science, 185 (1974), p. 435.]
140
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 3.30.
Изоакцепторные тРНК для валина у Е. соli. Эти две тРНК
различаются своими нуклеотидными последовательностями, антикодонами, типом и положением модифицированных оснований.
Акцепторный
конец
Акцепторный
стебель
ТψС- TψC-петля
стебель
DU-петля
Е. coli
– 5-карбоксиметоксиуридин
– N 6 -метиладенозин
– 7-метилгуанозин
– Дигидроуридин
– 4-тиоуридин
Т – Тимидин
ψ – Псевдоуридин
зультате АТР-зависимой реакции, катализируемой
специфическими ферментами аминоацил-тРНК-синтетазами (рис. 3.31). В ходе реакции АТР расщепляется на 5'-адениловую кислоту (AMP) и неорганический фосфат (РРi), а высвобождаемая при этом
энергия используется для присоединения карбоксильной группы аминокислоты к одной из гидроксильных групп рибозы на 3'-конце тРНК. На самом
деле образование аминоацил-тРНК проходит в два
этапа. На первом этапе карбоксильная группа аминокислоты присоединяется к α-фосфату АТР, что
сопровождается высвобождением неорганического
фосфата и образованием аминоацил-аденилата.
Аминоацил-аденилат обладает очень высокой реакционной способностью и стабилизируется благодаря прочному связыванию с ферментом. Второй
этап состоит в переносе аминоацильной группы от
связанного с ферментом аминоацил-аденилата на 2'или 3'-ОН-группу концевой рибозы тРНК. Потенциала переноса ацильной группы аминоацил-тРНК
более чем достаточно для образования пептидной
связи без дополнительного поступления энергии.
Ключевой особенностью реакции, приводящей
к аминоацетилированию тРНК, является специфичность участвующих в ней ферментов. Присоедине-
Антикодоновый
стебель
Вариабельная
петля
Антикодоновая
петля
Антикодон
ние к тРНК каждой из 20 аминокислот, встречающихся в белках, катализируется определенной аминоацил-тРНК-синтетазой. Фермент должен отличить одну аминокислоту от 19 других и перенести ее
к одной или нескольким изоакцепторным тРНК из
имеющихся примерно 75 других тРНК. Вспомним
при этом, что многие аминокислоты очень сходны
по структуре: лейцин, валин и изолейцин; валин
и треонин; аспарагиновая и глутаминовая кислоты.
Аминоацил-тРНК-синтетазы должны отличить
«свои» тРНК от всех других, несмотря на удивительное сходство их вторичной и третичной структур. Поэтому необходимо, чтобы ферменты обладали очень высокой специфичностью, позволяющей
им сделать правильный выбор из столь родственных структур и избежать ошибок при синтезе белка.
Комментарий по поводу структур аминоацилтРНК-синтетаз и их способности к узнаванию
аминокислот и родственных тРНК. Многие аминоацил-тРНК-синтетазы удалось очистить. Некоторые из них состоят из одной полипептидной цепи,
другие – из двух или четырех идентичных цепей,
каждая мол. массой от 35 до 115 кДа. Некоторые
димерные и тетрамерные ферменты состоят из субъединиц двух типов. Четкой корреляции между раз-
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
ATP
Аминокислота
Аминоацил-тРНКсинтетаза
141
РИС. 3.31.
Неорганический
пирофосфат
Образование аминоацил-тРНК. Аминоацил-тРНК-синтетаза катализирует образование ферментсвязанного промежуточного продукта аминоацил-аденилата, с помощью которого аминоацильная единица
переносится на тРНК.
Синтетаза
+
AMP
Аминоацил-тРНК
мером молекулы фермента или характером его
субъединичной структуры и специфичностью не существует.
Исследования взаимодействия между аминоацил-тРНК-синтетазами и родственными им тРНК
не позволили выяснить природу их высокой специфичности. Большинство работ показало, что специфичность фермента определяется его прочным связыванием с акцепторным концом тРНК, DU-участком и вариабельной петлей. Некоторые ферменты,
по-видимому, не распознают антикодоновый триплет и катализируют реакцию аминоацетилирования
даже при измененном антикодоне. Однако отдельные ферменты проявляют пониженную активность
по отношению к таким модифицированным тРНК
и при замене антикодона присоединяют не ту аминокислоту. Следовательно, в некоторых случаях существенным оказывается и взаимодействие с антикодоновой петлей. В любом случае акцепторный
конец тРНК должен быть ориентирован так, чтобы
каталитический центр фермента смог перенести связанный аминоацил-аденилат к концевому нуклеотиду тРНК.
В какой-то степени способность фермента присоединять нужную аминокислоту к родственной
тРНК зависит от специфического связывания аминокислоты. Однако, если безошибочное распознавание родственных аминокислот невозможно, синтетазы могут исправлять ошибки, происходящие при
присоединении. Например, нельзя полностью исключить возможность связывания валина изолейцил-тРНК-синтетазой из-за сходства размера и
структуры изолейцина и валина. Дефект в специфичности обнаруживается в первой же реакции: изолейцил-тРНК-синтетаза образует ферментсвязанный валил-аденилат, хотя и с меньшей эффективностью, чем изолейцил-аденилат, однако такой активированный валин не связывается ни с TPHK V a l , ни
с тРНК I l e . Вместо этого ферментсвязанный валилАМР быстро гидролизуется в присутствии тРНК I l e ,
142
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ
и образование валил-тРНК Ile предотвращается. Подобный механизм позволяет валил-тРНК-синтетазе различать валин и треонин, а метионил-тРНКсинтетазе отличать треонин от метионина. Очевидно, что аминоацил-тРНК-синтетазы пользуются
механизмом коррекции с целью предотвращения
неизбежных ошибок в аминоацетилировании тРНК.
И напротив, механизм, с помощью которого удалялась бы уже присоединенная к тРНК неправильная
аминокислота, отсутствует. В таких случаях аминокислота занимает неправильную позицию в белке.
Частота таких ошибок очень низка. В гемоглобине
кролика, например, валин оказывается в местах,
обычно занимаемых изолейцином, только в одном
из 25000–50000 возможных случаев (число остатков
изолейцина в белке). Таким образом, точность первого шага на сложном пути считывания генетической информации обеспечивается четкой работой
разных аминоацил-тРНК.
б. На рибосомах осуществляются
спаривание аминоацил-тРНК
с кодонами и сборка белковых цепей
Во всех клетках имеются рибосомы, играющие
ключевую роль в синтезе белка; их число колеблется
от 20000 до 50000 в зависимости от белоксинтезирующей активности клеток. Рибосомы индифферентны в отношении синтезируемых ими белков или
тех клеточных мишеней, к которым они направляют
синтезированные продукты. Тип синтезируемого рибосомой белка в каждом синтетическом цикле диктуется мРНК, с которой рибосома оказалась связанной. Внутри- или внеклеточная локализация белков
определяется их структурными особенностями и – в
зависимости от этих особенностей – характером
взаимодействия со специализированными мембранами и органеллами.
Рибосомы про- и эукариот обладают в общем
очень сходными структурой и функциями. Тем не
менее из-за различий в структуре и организации
про- и эукариотических мРНК и из-за того, что
процессы транскрипции и трансляции у эукариот
являются сопряженными во времени и в пространстве, тонкие различия между рибосомами про- и эукариот имеются. Типичными прокариотическими рибосомами являются рибосомы Е. coli, и поскольку
их структура и функции изучены лучше остальных,
мы используем эту модель в последующем обсуждении. Для сравнения мы остановимся на некоторых
структурных особенностях рибосом эукариот.
Строение рибосомных частиц. Рибосомы прокариот (называемые 70S-частицами из-за их седиментационных свойств) состоят из малых (30S) и больших (50S) субчастиц (рис. 3.32). 30S-субчастицы состоят из единственной молекулы рРНК (16S) разме-
НАСЛЕДСТВЕННОСТИ: ОБЗОР
ром 1542 нуклеотида и 21 белка с разной мол.
массой (S1–S21). 50S-субчастицы содержат две
рРНК – большую (23S), состоящую из 2904 нуклеотидов, и более мелкие (5S), из 120 нуклеотидов; они
связаны с 34 разными белками (L1–L34). Нуклеотидные и аминокислотные последовательности всех
рРНК и белков известны. Электронно-микроскопические исследования 70S-рибосом (рис. 3.33) и построения их трехмерных моделей (рис. 3.34) показали,
что малая и большая субчастицы соприкасаются
в нескольких точках, но самой характерной особенностью является наличие бороздки между ними,
необходимой, по-видимому, для размещения в ней
мРНК на время трансляции.
И малая, и большая рибосомные субчастицы
могут диссоциировать на составляющие молекулы
РНК и белка. Более того, даже после отделения друг
от друга молекулы всех РНК и белков способны
восстанавливать исходную функционально активную рибосомную субчастицу, если их смешать в соответствующих условиях. Это означает, что вся
информация о сборке мультимерного комплекса
заключена в структуре его компонентов. Эксперименты по реконструированию рибосом позволяют
лучше понять характер взаимодействия между этими компонентами и определить возможный порядок, в котором собираются белки и РНК in vivo.
Кроме того, в подобных экспериментах можно проверить совместимость эквивалентных РНК или белковых субчастиц из различных источников (например, из отдаленно родственных прокариот или из
прокариот и эукариот). Далее, с помощью этого
метода можно оценить способность мутантных
РНК или белков к взаимодействию с восстановлением структуры рибосом и проявлению различных
видов активности, присущих реконструированным
рибосомам.
Рибосомы эукариот, находящиеся в цитозоле,
также состоят из малых (40S) и больших (60S)
субчастиц (рис. 3.32). Малые субчастицы содержат
одну молекулу РНК (18S) размером 1900 нуклеотидов и 30-35 белков; большие – три цепи РНК длиной
120 (5S), 160 (5,8S) и 4800 (28S) нуклеотидов и 45–50
белков. Рибосомы митохондрий и хлоропластов
отличаются от цитозольных рибосом. Как правило,
они меньше и содержат меньшее количество белков
и различных рРНК. Данные по физическому и химическому реконструированию более сложных эукариотических хромосом значительно уступают аналогичным данным, полученным для Е. coli.
Необходимо выделить два важных в функциональном отношении участка, образующихся при
ассоциации субчастиц в процессе формирования
70S-рибосомы (рис. 3.35). Это участки, в которых
происходит связывание двух тРНК – одной, присоединенной к растущей белковой цепи (Р-участок),
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
143
21 нм
29 нм
Мол. масса 2800000
Рибосома прокариот
Мол. масса 1 800 000
5S-РНК
Мол. масса 1 000 000
16S-РНК
23S-РНК
120
нуклеотидов
1500
нуклеотидов
3000
нуклеотидов
~ 22 нм
34 белка
21 белок
~ 32 нм
Мол. масса 4 500 000
Рибосома эукариот
Мол. масса 1 500 000
18S-PHK
5,8S-РНК
Мол. масса 3 000 000
28S-PHK
5S-PHK
120
нуклеотидов
160
нуклеотидов
2000
нуклеотидов
30–35 белков
5000
нуклеотидов
45–50 белков
РИС. 3.32.
Состав типичных рибосом про- и эукариот.
и другой, несущей следующую добавляемую к цепи
аминокислоту (А-участок) (разд. 3.6. б).
Особые тРНК и некоторые вспомогательные белки, участвующие в трансляции. Как у про-, так
и у эукариот имеются два вида тРНК, которые
связывают метионин. У прокариот они обозначаются как тРНКFMet и тРНКMMet, а у эукариот – соответственно тРНКIMet и тРНКMMet. Каждая из обоих видов
тРНКМet как у про-, так и у эукариот аминоацетили-
руется метионином с помощью соответствующих
аминоацил-тРНК-синтетаз. тРНКFMet прокариот и
тРНКIМet эукариот обладают необычными свойствами, позволяющими им функционировать в качестве
адапторов при инициации синтеза полипептидной
цепи в соответствующих инициаторных AUG-кодонах. тРНКMMet про- и эукариот узнают AUG-кодоны
в белок-кодирующих последовательностях.
У прокариот аминогруппа метионил-тРНКFMet
144
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ
НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 3.33.
Электронные микрофотографии рибосом Е. соli. Буквами S и L на нижнем левом фото обозначены соответственно 30S- и 50S-субчастицы. Стрелкой отмечена бороздка между двумя субчастицами. На верхней фотографии видны 70S-моносомы при увеличении 350000.
На фото внизу представлены при большем увеличении
(560000) 70S-рибосомы, а также большая (50S) и малая (30S) субчастицы. [М. Boublik, Cytologie 14 (1977),
p. 203.]
30S
60S
70S
Щель
Тело
Головка
Тело
Головка
Малая субчастица
РИС. 3.34.
Реконструированные изображения 30S-, 50S- и 70S-рибосом E. соli, полученные с помощью данных электронной дифракции. Субчастицы представлены в двух
взаимно перпендикулярных проекциях. [J.A. Lake,
Scientific American, 245 (1981), p. 84.]
Палец
Палец
Тело
Протуберанец
Большая субчастица
Рибосома
Тело
(met-TPHKFMet), но не метионил-тРНКMMet (metтРНКMMet) формилируется особым ферментом (метионил-тРНК-трансформилазой) до Fmet-TPHKFMet с
использованием в качестве донора формильной
группы N10-формилтетрагидрофолата (рис. 3.36).
Очевидно, трансформилаза отличает met-TPHKFMet
от met-TPHKMMet. Fmet-TPHKFMet используется исключительно для инициации белковых цепей, a metTPHKMMet – только для декодирования внутренних
метиониновых кодонов. Несмотря на то что
тРНКIМet эукариот также используется только для
инициации, ее метионильная группа не подвергается
формилированию. Очевидно, некие особые свойства, присущие тРНКIMet и необходимые для выполнения ею специальной инициаторной функции, связаны исключительно с ее нуклеотидной последовательностью и/или трехмерной структурой.
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Участок
связывания
мРНК
РИС. 3.35.
Схема, показывающая расположение Р- и А-участков
в 70S-рибосоме E. соli. В формирование этих участков,
по-видимому, вовлечены как 30S-, так и 50S-субчастицы. Показана предполагаемая область связывания мРНК.
Известны белки, которые только временно, на
период трансляции, связываются с рибосомами.
Они играют важную роль при инициации, элонгации и терминации синтеза белковой цепи. Прежде
чем подробно обсуждать эти процессы (разд. 3.6),
мы познакомим читателя с такими белками и кратко опишем их свойства и роль в трансляции.
Эти белки, называемые факторами инициации
и обозначаемые IF-1, IF-2 и IF-3, необходимы для
инициации трансляции мРНК с образованием белков. IF-1 и IF-3 связываются с 30S-субчастицей, что
обеспечивает ее взаимодействие с комплексом, образуемым IF-2 и уникальной инициаторной аминоацил-тРНК, Fmet-тРНКFMet. Именно комплекс 30Sсубчастицы со всеми факторами инициации и FmetтРНКFMet узнает соответствующий AUG-кодон в
145
мРНК. Когда формирование инициаторного комплекса завершается присоединением 50S-субчастицы, все три инициаторных белка отсоединяются.
Для доставки следующей аминоацил-тРНК к рибосоме нужны два белка, называемые факторами
элонгации, EF-Tu и EF-Ts. EF-Tu с присоединенным
к нему GTP связывает все аминоацил-тРНК, кроме
Met
Fmet-TPHKF , и доставляет их к А-участку комплекса 70S-рибосома-мРНК. По ходу процесса образуется EF-Tu-GDP, и для восстановления EF-Tu-GTP
нужен EF-Ts. В элонгации цепи участвует еще один
белок, EF-G; он обеспечивает перемещение рибосомы по мРНК при трансляции кодонов. Для терминации синтеза полипептидной цепи в одном из трех
стоп-кодонов также нужны особые белки, только
временно присоединяющиеся к трансляционному
комплексу. Известны три таких белка: RF-1 вызывает отделение полипептидной цепи при считывании
кодонов UAA и UAG; RF-2 действует аналогичным
образом при считывании UAA и UGA, a EF-3 может
облегчить работу двух других факторов.
Все многообразие вспомогательных белков, необходимых на различных этапах сборки белков
в клетках эукариот, изучено значительно слабее,
а их функции пока недостаточно ясны. Для инициации нужно не менее пяти таких белков; некоторые из
них по своим функциям, по-видимому, аналогичны
прокариотическим белкам IF-2 и IF-3. Более сложно
устроен и аппарат элонгации; он снабжен значительно большим количеством белков, участвующих как
в связывании аминоацил-тРНК с рибосомами, так
и в перемещении рибосом. Терминация трансляции
у эукариот также изучена слабо; тем не менее здесь,
по-видимому, необходим только один белок (eRF).
Важным этапом терминации или отделения белковой цепи от мРНК является гидролиз GTP.
3.6. ТРАНСЛЯЦИЯ мРНК
У ПРОКАРИОТ
РИС. 3.36.
Формирование метионил-тРНКFMet у E. coli.
Зная всех участников процесса, мы можем теперь
приступить к рассмотрению химических реакций,
протекающих при синтезе полипептидов, т.е. реакций, участвующих в собственно трансляции. Несмотря на то что этот процесс протекает непрерывно от старта к финишу, обычно выделяют три его
этапа: инициацию, элонгацию и терминацию. Рассматривая каждый из этапов направляемого мРНК
синтеза полипептидной цепи, мы должны учитывать
два основных свойства этого процесса. Во-первых,
полипептидные цепи синтезируются однонаправленно: с амино-конца к карбокси-концу (рис. 3.37). При
этом карбоксильная группа уже образовавшегося
участка полипептидной цепи соединяется с аминогруппой следующей присоединяемой аминокислоты
с помощью пептидной связи. Это может произойти,
146
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
мРНК
РИС. 3.37.
Сборка полипептидной цепи. Кодоны
мРНК считываются один за другим
в направлении 5'–>3', начиная с инициаторного кодона AUG, который
связывается с N-формилметионилMet
тРНК F . Полипептид синтезируется
от N- к С-концу.
Растущая полипептидная цепь
Следующая
тРНК,
несущая
аминокислоту
Р-участок
А-участок
лишь если карбоксильный конец растущей полипептидной цепи находится в активированном состоянии. Как мы уже отмечали, необходимая для этого
энергия поступает в результате присоединения карбоксильной группы растущей полипептидной цепи
и каждой присоединяемой аминокислоты к тРНК
(рис. 3.38). Во-вторых, считывание мРНК начинается с кодона AUG, который обозначает 5'-конец
кодирующей последовательности и детерминирует
N-концевую аминокислоту синтезируемого полипептида (рис. 3.37). При инициации первая и вторая
молекулы аминоацил-тРНК спариваются с первыми
двумя кодонами мРНК. Далее трансляция продолжается в направлении 5'–>3' кодон за кодоном до
тех пор, пока не достигнет стоп-сигнала, расположенного сразу же за кодоном, детерминирующим
С-концевую аминокислоту.
а. Условия инициации
РИС. 3.38.
Этапы пептидилтрансферазной реакции. Азот аминогруппы присоединяющейся аминокислоты осуществляет
нуклеофильную атаку активированной карбоксильной
группы растущей цепи, в результате чего образуется
новая пептидная связь.
70S-рибосома способна осуществлять трансляцию последовательности мРНК, но не может инициировать этот процесс. При связывании инициаторных белков IF-1 и IF-2 с 30S-субчастицей происходит диссоциация 70S-рибосомы. 30S-субчастица в
комплексе с IF-1 и IF-3 связывает IF-2, GTP и FmetтРНКFMet. Такой полный комплекс связывается с
5'-концом кодирующей последовательности мРНК
вблизи кодона AUG (рис. 3.39). Очевидно, IF-2 способен отличить Fmet-тРНКFMet от met-тPHKMMet, и эта
специфичность отчасти обеспечивается N-формильной группой, отсутствующей у met-TPHKMMet. Формирование полноценного функционального комплекса инициации завершается ассоциацией 50S-субчастицы с преинициаторным комплексом. С образо-
147
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
РИС. 3.39.
События,
предшествующие
инициации
трансляции. При связывании IF-1 и IF-3
с 30S-субчастицей происходит диссоциация
70S-рибосомы. Затем образуется преинициирующий комплекс, состоящий из 30SMet
субчастицы, N-формилметинил-тРНКF
и
мРНК. Последующая ассоциация этого комплекса с 50S-субчастицей сопровождается
отделением IF-1, IF-2 и IF-3 и гидролизом
одной молекулы GTP до GDP.
Рибосома
IF3
IF1
Fmet
Fmet
GTP, IF2
мРНК
GDP + Pi
ванием функциональной 70S-субчастицы отделяются все три белка инициации.
Как узнается первый кодон? Связывание 30S-субчастицы с мРНК находится под строгим контролем
нуклеотидной последовательности, расположенной
примерно за 10 нуклеотидов до 5'-конца инициаторного кодона. Взаимодействию способствует комплементарное спаривание этой богатой пуринами последовательности из пяти-восьми нуклеотидов, называемой последовательностью Шайна-Дальгарно,
с полипиримидиновым участком, находящимся
вблизи 3'-конца 16S-pPHK (рис. 3.40). Эффективность инициации существенно зависит от степени
комплементарности между последовательностями
Шайна-Дальгарно и 16S-pPHK и от расстояния
пурин-богатого участка до кодона AUG. Эта особенность наряду с другими, о которых будет сказано позднее, и объясняет различия в эффективности
трансляции различных мРНК.
Процесс инициации зависит также от вторичной
Arg
Phe
Ala
Ser
Белок
мРНК
16S-pPHK
РИС. 3.40.
Богатая пуринами последовательность Шайна-Дальгарно, расположенная до инициирущего кодона AUG,
спаривается с участком, находящимся вблизи 3'-конца
φ X 1 7 4 : А-белок
Qβ: репликаза
Rl7: А-белок
λ: сrо-белок
16S-pPHK E. coli. В нижней части рисунка приведены
типичные последовательности Шайна-Дальгарно в
мРНК некоторых бактериофагов.
148
РИС. 3.41.
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Первичная и предполагаемая вторичная структуры
5'-концевой части генома бактериофага MS2. Несколько инициирующих кодонов (в том числе необычный
кодон GUG вблизи 5'-конца) оказываются экранированными при внутримолекулярном спаривании оснований. Только кодон AUG (показан стрелкой), находящийся на вершине шпильки, остается доступным и связывается с рибосомами сразу после инфекции. Участок
последовательности, начинающийся после кодона AUG,
кодирует белок оболочки MS2. Заметим, что последовательность Шайна-Дальгарно, находящаяся перед
кодоном AUG в этой модели, также относительно
доступна; два остатка G образуют слабые водородные
связи с остатками U. (С любезного разрешения
W. Fiers.)
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
149
150
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
структуры того участка молекулы мРНК, в котором
находится инициаторный кодон AUG. Если этот
кодон окажется внутри двухцепочечного участка, то
инициация будет неэффективна или вовсе блокируется (рис. 3.41). Именно таким образом может регулироваться доступность инициаторного AUG-кодона для 30S-рибосомы. AUG становится недоступным, если он оказывается спаренным при образовании конденсированной формы зрелой мРНК, и, напротив, доступным для инициации во время транскрипции мРНК или во время трансляции других
кодирующих последовательностей на той же молекуле мРНК.
б. Элонгация полипептидной цепи
При ассоциации двух рибосомных субчастиц перед инициацией трансляции образуются два функциональных участка, необходимых для сборки белMet
ка: Р- и А-участки. Fmet-TPHKF занимает Р-участок, а для образования первой пептидной связи
необходимо, чтобы аминоацил-тРНК, соответствующая следующему кодону, заняла А-участок. Для
этого аминоацил-тРНК должна сначала связать EFTu и GTP. Образовавшийся тройной комплекс
(аминоацил-тРНК-[ЕF-Тu-GТР]) и доставляет аминоацил-тРНК к А-участку (рис. 3.42). GTP в это
время гидролизуется, и комплекс (EF-Tu-GDP) отделяется от рибосомы. Когда оба участка, А и Р,
заняты, пептидилтрансферазная активность 50S-субчастицы катализирует перенос группы Fmet с ее
тРНК на аминогруппу аминоацил-тРНК, находящейся в А-участке. В результате в А-участке оказывается дипептидил-тРНК, а в Р – свободная тРНК.
Для прочтения следующего кодона и удлинения
полипептидной цепи еще на одну аминокислоту вся
серия реакций должна повториться. Однако, прежде
чем это произойдет, тРНК должна освободить Ручасток, образовавшаяся дипептидил-тРНК должна
переместиться на него, а новый кодон должен быть
готов к тому, чтобы занять освободившийся А-участок (рис. 3.43). Все эти процессы осуществляются
с помощью EF-G при GTP-зависимой транслокации
рибосомы. Источником энергии для перемещения
рибосомы к следующему триплету кодирующей последовательности и удаления свободной тРНК из
Р-сайта служит реакция гидролиза GTP до GDP.
Теперь новый кодон, занявший А-сайт, готов к спариванию с родственной аминоацил-тРНК.
Сразу после связывания аминоацил-тРНК с Аучастком высвобождается комплекс EF-Tu-GDP и
происходит регенерация функционально активного
EF-Tu-GTP (рис. 3.44). При этом EF-Tu-GDP взаимодействует с белком EF-Ts, что приводит к отделению GDP и образованию комплекса EF-Tu•EF-Ts.
Далее EF-Tu•EF-Ts взаимодействует с GTP, проис-
GTP
Ala
EF-Tu
Ala-тРНК
Ala
GTP
Тройной
комплекс
GDP
Тройной комплекс
занимает А-участок
рибосомы
Fmet
EF-Tu
Ala
+ Pi
Пептидилтрансфераза
Fmet-Ala
РИС. 3.42.
Образование первой пептидной связи. Преинициирующий комплекс 70S-рибосомы с мРНК и N-формилметионил-тРНКFMet, находящийся в Р-участке, связывает
тройной комплекс аланил-тРНКАlа-EF-Tu-GTP. АланилтРНК Аlа перемещается к А-участку и связывается со
вторым кодоном, GCU, с помощью антикодона
5'-AGC-3'. GTP гидролизуется, и комплекс EF-Tu-GDP
отделяется. В результате пептидилтрансферазной реакции дипептидил-тРНК занимает А-участок.
ходит регенерация EF-Tu-GTP и отделение EF-Ts,
и оба соединения оказываются готовыми к следующему циклу.
Необходимо отметить несколько особенностей
процесса элонгации. 1. При образовании каждой
пептидной связи расходуется энергия, равная четырем энергетическим эквивалентам (если за один
эквивалент принять энергию образования фосфат-
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
151
ной связи): два эквивалента АТР потребляются при
аминоацилировании тРНК и два эквивалента GTPв каждом цикле элонгации. 2. При инициации трансMet
ляции IF-2 узнает Fmet-тРНКF среди всех других
Met
аминоацил-тРНК, a EF-Tu отличает met-тРНКF от
Met
Fmet-тРНКM при внедрении в А-участок. 3. Факторы элонгации EF-Tu и EF-G то присоединяются, то
отделяются от рибосомы в зависимости от того,
связаны ли они с GTP или с GDP соответственно.
4. Растущая полипептидная цепь всегда соединена
своим карбоксильным концом с тРНК, которая
соответствует С-концевой аминокислоте в растущей
полипептидной цепи. 5. Пептидилтрансфераза катализирует формирование пептидных связей между
карбоксильным концом растущей цепи и аминогруппой аминоацил-тРНК.
Fmet-Ala
GTP, EF-G
в. Терминация элонгации
полипептидной цепи
EF-G
+
GDP
+P
РИС. 3.43.
Элонгация полипептидной цепи. Фактор EF-G осуществляет GTP-зависимое перемещение 70S-рибосомы вдоль
мРНК. Далее GTP гидролизуется, тРНК удаляется из
Р-участка и пептидил-тРНК перемещается из А-участка
на освободившийся Р-участок. Теперь А-участок и следующий кодон готовы принять «свою» аминоацилтРНК.
EF-Tu-GTP
Перемещение
аминоацил-тРНК
на А-участок
EF-Tu-GDP + Pi
EF-Ts
EF-Tu•EF-Ts + GDP
GTP
EF-Tu-GTP + EF-Ts
РИС. 3.44.
Регенерация EF-Tu-GTP после высвобождения EF-Tu-GDP из комплекса с аминоацил-тРНК.
i
Процесс последовательной трансляции кодонов
в конце концов доходит до того момента, когда
в А-участке оказывается один из трех терминирующих кодонов – UAG, UAA или UGA (рис. 3.45). Изза отсутствия тРНК, отвечающих этим кодонам,
полипептидил-тРНК остается связанной с Р-участком. Здесь вступают в действие специфические факторы RF-1 и RF-2, которые катализируют отсоединение полипептидной цепи от тРНК, отделение их
обоих от рибосомы, а 70S-рибосомы – от мРНК.
RF-1 узнает в А-участке кодон UAA или UAG; RF-2
включается в том случае, когда в А-участке оказывается UAA или UGA; RF-3 облегчает работу двух
других факторов. Если терминирующим кодоном
является UAA, то эффективность процесса терминации оказывается наибольшей, поскольку этот кодон
узнают оба фактора – RF-1 и RF-2. Однако, каким
бы из стоп-кодонов ни обеспечивалась терминация,
ее эффективность зависит от фланкирующих эти
кодоны последовательностей в мРНК. Хотя общие
черты и даже некоторые детали процесса терминации известны, точный его механизм и каталитическая роль факторов RF-1 и RF-2 пока неясны.
3.7. НЕКОТОРЫЕ
ОБЩИЕ ОСОБЕННОСТИ
ПРОЦЕССА ТРАНСЛЯЦИИ
В предыдущем разделе мы подробно рассмотрели события одного цикла трансляции мРНК на
рибосоме. Здесь акцент будет сделан на некоторых
общих принципах процесса в целом и на нарушении
или блокировании его отдельных стадий.
152
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
а. Одновременная трансляция
молекулы мРНК
более чем одной рибосомой
Связывание фактора
освобождения
со стоп-кодоном
Отщепление
пептидной цепи
от тРНК
После инициации трансляции 70S-рибосома перемещается от сайта инициации по мере считывания
каждого последующего кодона. Когда расстояние
от рибосомы до сайта инициации достигнет величины 100–200 нуклеотидов, в этом сайте может произойти новая инициация (рис. 3.46). Более того, как
только вторая рибосома пройдет такое же расстояние, может произойти третья инициация, и т.д.
Итак, одну и ту же белок-кодирующую последовательность мРНК могут одновременно транслировать несколько рибосом. Подобные мультирибосомные трансляционные комплексы называются полирибосомами или полисомами. Каждая рибосома
полисомы обязательно целиком транслирует кодирующую последовательность с образованием полноразмерного полипептида. От каждой рибосомы
в полисоме отходит полипептид, длина которого
соответствует расстоянию, пройденному рибосомой
от сайта инициации. Эта длина пропорционально
увеличивается по мере продвижения рибосомы по
мРНК, начиная с 5'-конца кодирующей последовательности.
б. Трансляция бактериальных мРНК
может осуществляться параллельно
транскрипции
РИС. 3.45.
Терминация трансляции. Когда в А-участке оказывается
один из стоп-кодонов, факторы освобождения инициируют серию реакций, приводящую к отделению синтезированной полипептидной цепи, тРНК и мРНК от
70S-рибосомы.
Образование мРНК при транскрипции гена или
кластера генов начинается с 5'-конца в направлении
к 3'-концу (разд. 3.2). Следовательно, формирование
комплекса инициации трансляции может произойти
сразу же после того, как будет транскрибирована
последовательность, в пределах которой находится
инициирующий кодон (рис. 3.47). И в самом деле,
синтез полипептидной цепи обычно начинается до
завершения транскрипции 3'-концевой части мРНК.
Если бактериальная транскрипционная единица
содержит более одной кодирующей белок последовательности, как, например, в случае trp- или lacоперонов (разд. 3.11), то на рибосомах может начаться и даже завершиться трансляция первой из
этих кодирующих последовательностей еще до
окончания транскрипции остальных. Матричные
РНК, состоящие из многих белок-кодирующих
участков, часто транслируются последовательно,
т.е. инициация, элонгация и терминация трансляции
первой кодирующей последовательности сопровождаются такими же событиями на втором, третьем
и последующих кодирующих сегментах. После того
как рибосомы доходят до сигнала терминации в
первой или любой другой кодирующей последовательности, они отделяются от мРНК, и со следую-
153
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
70S
Инициирующий
кодон
Терминирующий
кодон
Матричная РНК
РИС. 3.46.
Образование полирибосомы. После того как первая
рибосома удалится от сайта инициации на определенное расстояние, вторая образует инициаторный комплекс в том же сайте и начинает трансляцию. То же самое
щим инициаторным участком связывается новый
комплекс. Однако в некоторых случаях рибосомы
не отделяются от мРНК, а перемещаются вдоль
молекулы, образуя новые комплексы инициации
в других сайтах.
в. Рибосомы начинают новый раунд
после трансляции кодирующей
последовательности
Как мы уже говорили, когда осуществляющая
трансляцию 70S-рибосома доходит до терминирующего кодона, полноразмерная полипептидная цепь
отделяется от мРНК, а обе они – полипептид и
тРНК – отделяются от рибосомы, и происходит разделение 70S-рибосомы и мРНК. 70S-рибосомы не
способны к инициации новых раундов синтеза полипептидов и, следовательно, должны диссоциировать
на составляющие их 50S- и 30S-субчастицы. Такая
диссоциация контролируется фактором инициации
IF-3 совместно с IF-1 (рис. 3.48). «Рибосомный»
цикл завершается ассоциацией 50S-субчастицы с
30S-субчастицей, связанной с мРНК и несущей IF-2,
Fmet-тРНКFMet и GTP, с образованием функционального трансляционного 70S-аппарата (рис. 3.39). Таким образом, изменяя количество 30S- и 50S-субчастиц по отношению к их предшественнику – 70S-рибосоме,– фактор IF-3 осуществляет общий контроль
уровня белкового синтеза.
затем проделывает третья рибосома и т.д. В результате
на одной и той же мРНК могут одновременно синтезироваться сразу несколько полипептидов.
г. Взаимодействие кодона
и антикодона
Большинство молекул тРНК спаривается более
чем с одним кодоном. Поскольку кодоны транслируются при участии антикодонов разных тРНК, можно было бы ожидать, что для каждого из 61 кодона,
детерминирующего аминокислоты, имеется своя
тРНК. Однако не существует ни разных тРНК для
каждого из четырех валиновых или глициновых
кодонов, ни разных тРНК для обоих тирозиновых
или обоих лизиновых кодонов. Действительно, эксперименты in vitro и in vivo показали, что некоторые
тРНК могут транслировать более чем один кодон.
Так, кодоны UAU и UAC транслирует единственная
тРНКТуr (рис. 3.49). Поскольку антикодон этой
тРНКТуr имеет последовательность 5'-GUA-3', он
может образовать комплементарные пары с первыми двумя основаниями любого из этих кодонов
(напомним, что спаривание происходит между антипараллельно ориентированными последовательностями). Соответственно G способен спариваться как
с U, так и с С, находящимися в третьем положении
кодонов; аналогичным образом U, находясь на
5'-конце какого-либо антикодона, может спариться
и с А, и с G, находящимися на 3'-конце соответствующих кодонов. На самом деле трансляция всех
пар кодонов, у которых в третьей (3') позиции стоит
U или С, может осуществляться одной и той же
тРНК, у которой первым основанием в антикодоне
оказывается G или какое-то модифицированное основание. По-видимому, при спаривании кодонов
и антикодонов в А- и Р-участках включаются какието стабилизирующие взаимодействия, отличные от
154
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
А
РИС. 3.47.
Транскрипция и трансляция у прокариот идут параллельно. А. Схематическое представление транскрипции
ДНК и параллельной трансляции мРНК полирибосомами. Б. Электронная микрофотография, на которой видны рибосомы, прикрепившиеся к молекулам РНК, кото-
рые транскрибируются с ДНК Е. соli. К более длинным
цепям РНК, находящимся на большем расстоянии от
сайта инициации транскрипции, прикреплено и больше
рибосом (142000 х). [О.L. Miller, Jr., B.A. Hamkalo,
С.A. Thomas, Jr., Science, 169 (1970), p. 392.]
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
155
Б
Динамическое
равновесие
IF-3
Пул 70S-рибосом
IF-1
Fmet
Инициаторный
комплекс
GTP
мРНК
IF-2
мРНК
GDP
IF-1,
IF-2, IF-3
Fmet
РИС. 3.48.
«Рабочий цикл» 70S-рибосом при синтезе
белка.
мРНК
156
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Тирозиновые кодоны
РИС. 3.49.
Большинство молекул тРНК спаривается более чем с одним кодоном.
Тирозиновые кодоны UAU и UAC
транслируются с помощью одной
Туr
тРНК . Аналогично кодоны GAA
и GAG для глутаминовой кислоты
транслируются с помощью одной
Glu
Тrр
тРНК . В то же время тРНК узнает триптофановый кодон UGG, но не
узнает терминирующий кодон UGA.
Кодоны глутаминовой кислоты
Триптофановый кодон
Терминирующий
тех, которые имеют место при обычном комплементарном спаривании оснований.
Анализ генетического кода показывает, однако,
что существуют специфические взаимодействия, позволяющие различать кодоны, у которых в третьей
позиции стоит А или G. Например, тРНК, расшифровывающая кодон AUG как метионин, должна
отличать этот триплет от кодона AUA, обозначающего изолейцин, а тРНК Trр должна отличать триптофановый кодон UGG от терминирующего кодона
UGA. Специфичность обеих этих операций декодирования определяется спариванием С антикодона
с G, находящимся в третьем положении кодона
(рис. 3.49).
Модификация оснований в антикодонах может
еще сильнее ограничить диапазон возможных взаимодействий кодон-антикодон. Например, гипоксантин (Нх), занимая место аденина в той позиции
антикодона, по которой происходит спаривание с
третьим основанием кодона, может обусловить спаривание такого антикодона с кодонами, у которых
в последней позиции стоят основания U, С или А.
Разнообразие модификаций оснований в антикодонах или – что встречается наиболее часто – оснований, соседствующих с антикодоном, изменяет специфичность взаимодействия аминоацил-тРНК–ко-
кодон
дон. Таким способом обычно предотвращаются
ошибки при считывании третьего основания кодонов и обеспечивается надежность процесса декодирования.
Правила спаривания оснований, согласно которым молекулы тРНК одного типа могут узнавать
несколько разных кодонов, называются правилами
неоднозначного соответствия (или «качания» от
англ. "wobble" rules) (табл. 3.4). Следует отметить,
однако, что термин «качание», используемый для
описания некоторой свободы спаривания третьего
Таблица 3.4. Пары оснований, которые могут
образовываться согласно теории неоднозначного
соответствия
Основание антикодона,
спаривающееся с третьим
основанием кодона 1)
Третье основание кодона
G
С
А
U
Нх
U или С
G
U
А или G
A, U или С
1)
U, С, А, G - четыре обычных основания РНК; Нх - дезаминированная форма аденина - гипоксантин.
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
основания кодона, просто как бы затушевывает тот
факт, что мы до конца не знаем, какие именно
химические и структурные особенности обусловливают кодон-антикодоновые взаимодействия в Ри А-участках рибосомы.
Мутации в кодонах и антикодонах. Мутации,
затрагивающие различные компоненты трансляционного аппарата, могут изменить результат считывания кодирующей последовательности. Наиболее
драматичные последствия вызывают те мутации
в гене, кодирующем белок, которые превращают
кодон, отвечающий какой-то аминокислоте, в терминирующий кодон и тем самым приводят к преждевременному завершению синтеза из-за досрочной
терминации трансляции в мутировавшем сайте
(рис. 3.50). Примером может служить превращение
лизинового кодона ААА в UAA и глутаминового
кодона CAG в UAG. Аналогично любая мутация,
в результате которой происходит замена аминокислотного кодона на кодон UGA, тоже вызовет преждевременную остановку синтеза полипептидной цепи. Однако, если в результате второй мутации
произойдет изменение соответствующего основания
в антикодоне тРНК, терминация может быть предотвращена, или супрессирована, и образуется полноразмерный, хотя и измененный, белок (рис. 3.51).
Например, если тРНКТуr, тРНКLeu или тРНКSer изменятся подобным образом, то они смогут прочитать кодон UAG как аминокислотный. С помощью
различных механизмов может произойти ошибочная трансляция и таких мутантных кодонов, как
UAA и UGA. Мутации в тРНК-генах, затрагиваюмРНК
дикого типа
Мутации, приводящие
к терминации
Мутантная
мРНК 1
или
Мутантная
мРНК2
Синтезируемый
полипептид
Полипептид
дикого типа
Мутантный
полипептид1
Мутантный
полипептид2
РИС. 3.50.
Мутации, приводящие к превращению внутренних кодонов в терминирующие (стоп) кодоны, обусловливают
преждевременную терминацию трансляции.
157
щие основания, отличные от тех, которые составляют антикодон, могут привести к изменению специфичности или стабильности взаимодействий кодона
и антикодона. Благодаря таким механизмам может
быть предотвращена преждевременная терминация
синтеза полипептида, если терминирующий кодон
будет прочитан как смысловой. Подобная супрессия
терминации, как правило, не очень эффективна,
поэтому наряду с полноразмерными образуются
и укороченные, преждевременно терминированные
полипептидные цепи. Благодаря относительной неэффективности такой трансляционной супрессии не
приносит большого вреда и случайное проскакивание терминирующих кодонов, находящихся на естественных концах кодирующих мРНК.
Миссенс-мутации, т.е. мутации, приводящие к
аминокислотным заменам и соответственно к утрате белком его функции, также могут быть ревертированы благодаря супрессорным мутациям, вызывающим ошибочное считывание мутантного кодона
(рис. 3.52). Это может произойти в том случае, если
тРНК, несущая нужную аминокислоту или любую
другую, которая может быть включена в данный
сайт белковой цепи, имеет антикодон, способный
к спариванию с мутантным кодоном. Мутации,
вызывающие сдвиг рамки считывания кодирующей
последовательности, также могут быть супрессированы, если мутантные тРНК или рибосомы случайно транслируют два или четыре основания вместо
трех.
Итак, ошибки трансляции могут компенсировать
последствия нарушений кодирующей последовательности. Мутационные изменения в антикодоне
тРНК – это наиболее распространенный механизм
супрессии; изменения в других участках молекулы
тРНК могут привести к неправильной этерификации
аминокислот аминоацил-тРНК-синтетазами или
ошибочному спариванию на рибосоме. Ошибки в
трансляции могут возникать и в том случае, если
в результате мутаций происходит изменение белков
или РНК-компонент рибосом, участвующих в кодон-антикодоновом
взаимодействии.
Точность
трансляции уменьшается и под действием некоторых химических соединений (например, стрептомицина), которые связываются с рибосомными белками в 30S-субчастице. Такие случаи нарушения процесса трансляции приводят к более тяжелым последствиям.
3.8. ТРАНСЛЯЦИЯ мРНК
У ЭУКАРИОТ
Процесс трансляции эукариотической мРНК в
основном аналогичен таковому прокариотической
мРНК. За некоторыми отмеченными выше исключениями, генетический код универсален и кодоны по-
158
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
тРНК дикого типа
Супрессорные тРНК
РИС. 3.51.
Трансляционная супрессия терминирующих кодонов. Мутации, вызывающие изменения в антикодонах
тРНК Туr , тРНК Leu или тРНКSer, приводят к тому, что терминирующие кодоны считываются как кодоны, отвечающие определенным аминокислотам.
Это положение в белке
занимает глицин
Миссенс-мутант
В результате мутации
место глицина занял аргинин
Супрессорный мутант
РИС. 3.52.
Трансляционная супрессия миссенс-мутаций. В тРНКGly
произошло такое изменение антикодона, что аргининовый кодон был прочитан как глициновый.
Супрессорная
тРНКGly
с измененным антикодоном
узнает аргининовый кодон
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
следовательно транслируются с помощью специфических аминоацил-тРНК-синтетаз на рибосомах.
Есть, однако, и три явных различия, обусловленных
определенными свойствами эукариотических клеток. Во-первых, аппараты транскрипции и трансляции у эукариот физически разобщены, поскольку
транскрипция осуществляется в ядре, а трансляция –
в цитоплазме. Во-вторых, на 5'- и 3'-концах эукариотических мРНК имеются особые структуры. И втретьих, эукариотические мРНК, за исключением
мРНК, транскрибируемых с ДНК геномов вирусов,
обычно содержат только одну белок-кодирующую
последовательность.
Структура и свойства участников трансляции
эукариотической мРНК пока изучены гораздо хуже,
чем у прокариот. И хотя у эукариот выделяют те же
три стадии процесса – инициацию, элонгацию и терминацию,– на каждой из них требуется больше нерибосомных белковых факторов. Несмотря на эти
различия, последовательности, кодирующие белки
прокариот, нормально транслируются эукариотическими системами трансляции при условии соответствующей модификации их мРНК на 3'- и 5'-концах
(рис. 3.8, A). И наоборот, кодирующие последовательности эукариот эффективно транслируются системами прокариот, если у них перед 5'-концом
инициаторного кодона AUG имеется последовательность Шайна-Дальгарно. Это значит, что
трансляционные аппараты обоих типов организмов
могут осуществлять свои функции, несмотря на
особенности нуклеотидных последовательностей
мРНК из разных источников.
а. Особые модификации мРНК
эукариот
У эукариотических мРНК, транскрибированных
с ядерных или вирусных геномов РНК-полимеразой
II, всегда модифицированы 5'-концы, которые в
этом случае называют «кэпами» (рис. 3.53). РНК,
транскрибируемые эукариотическими РНК-полимеразами I (в том числе рРНК) и III (5S- и тРНК), не
кэпированы и имеют обычные 5'-фосфатные концы. У большинства мРНК, синтезируемых РНК-содержащими вирусами животных, также имеются
кэпы, хотя они синтезируются вирусными РНКтранскриптазами. Многие некэпированные мРНК
неэффективно транслируются эукариотическими белоксинтезирующими системами из-за слабого связывания рибосом с мРНК. Кэпирование происходит на 5'-нуклеозидтрифосфате вскоре после инициации синтеза РНК-транскриптов и задолго до его
завершения. Детали процесса кэпирования изложены в разд. 8.3.в.
На 3'-концах эукариотических мРНК имеются
еще и полиаденилатные последовательности. Такой
3'-«хвост» из 50–200 аденилатных остатков не кодируется смысловыми последовательностями соответ-
Метилгуаниловая кислота (кэп)
РИС. 3.53.
Кэп-структура на 5'-конце большинства эукариотических мРНК. Кроме 7-метилгуаниловой кислоты, присоединенной к первичному транскрипту
с помощью трифосфатного мостика, кэп часто
включает 2'-О-метильные группы, связанные с
первым или с первыми двумя рибозными остатками транскрипта.
159
Первичный транскрипт
160
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
ствующих генов, а присоединяется посттранскрипционно, после разрезания транскрипта в специфическом месте за сигналом терминации трансляции
(разд. 8.3.в).
б. Инициация трансляции
на 5'-кэпированных концах
малыми рибосомными субчастицами
Как мы уже говорили, обязательным этапом при
инициации трансляции прокариотической мРНК является диссоциация 70S-рибосомы; точно так же
и 80S-рибосомы должны диссоциировать до начала
трансляции эукариотических мРНК. Малая субчастица (40S) в комплексе со множеством белков-помощников (eIF), из которых один или несколько
нужны для диссоциации рибосомы на составляющие
субчастицы, связывает особую инициаторную metтPHKIMet. И вновь для связывания инициаторной
аминоацил-тРНК необходимы GTP и особый белок – eIF-2. У эукариот, однако, met-TPHKIMet не
подвергается N-формилированию; но, как и у прокариот, структура тРНКIMet отличается от структуры
тPHKMMet. Комплекс 40S, содержащий met-тPHK I Met ,
GTP и целую армию других факторов eIF, связывается с мРНК вблизи кэпированного 5'-конца или
прямо с этим концом; по крайней мере один из этих
факторов узнает кэп и связывается с ним. Малая
субчастица перемещается при помощи неизвестного
пока механизма от кэпированного конца до первого кодона AUG. Никакой последовательности вблизи кодона AUG, аналогичной последовательности
Шайна-Дальгарно, пока не обнаружено. Однако
эффективность работы AUG в качестве инициаторного кодона зависит от наличия определенных
фланкирующих нуклеотидов. Такой преинициаторный комплекс объединяется с 60S-субчастицей в ходе энерго- и фактор-зависимой реакции с образованием функционального комплекса инициации. Инициация белкового синтеза может регулироваться
фосфорилированием и дефосфорилированием eIF-2.
в. Элонгация и терминация
полипептидной цепи
Поэтапная трансляция последовательных кодонов с помощью аминоацил-тРНК у эу- и прокариот
в принципе сходна. GTP и фактор элонгации eEF-1,
соответствующий прокариотическому комплексу
EF-Tu и EF-Ts, периодически поставляют рибосомам аминоацил-тРНК. GTP и eEF-2, являющиеся
функциональными аналогами прокариотического
EF-G, осуществляют транслокацию. Терминация
трансляции у эукариот также происходит в одном из
трех стоп-кодонов и сопровождается отделением
свободных полипептидных цепей, мРНК и, возмож-
но, 80S-рибосом от мРНК. По-видимому, всю серию терминационных событий осуществляют один
фактор eRF и GTP.
Биогенез эукариотической мРНК детально обсуждается в разд. 8.3. Здесь мы лишь отметим, что
трансляция не начинается до тех пор, пока зрелая
мРНК не достигнет цитоплазмы, где и происходит
инициация. В результате последовательных актов
инициации образуются полисомы и одновременно,
как и у прокариот, начинается трансляция множества кодирующих белки последовательностей. Заметное отличие трансляции у эукариот состоит в том,
что клеточные мРНК обычно содержат одну-единственную кодирующую последовательность. Если в
мРНК имеется несколько таких областей, то последующие либо вовсе не транслируются, либо транслируются неэффективно.
3.9. ИНГИБИТОРЫ
ТРАНСКРИПЦИИ И ТРАНСЛЯЦИИ
Было исследовано огромное количество природных и синтетических соединений на их способность
оказывать противомикробное или противоопухолевое действие. Многие из них обладали высокой
ингибирующей активностью в отношении как транскрипции, так и трансляции у про- и эукариот.
Действие большинства таких соединений неспецифично, и они слишком токсичны для того, чтобы их
можно было использовать в терапевтических целях.
Однако некоторые из них оказались чрезвычайно
полезны для экспериментальных исследований аппаратов синтеза РНК и белка. Здесь мы упомянем
лишь о некоторых из таких соединений.
а. Ингибирование РНК-полимеразы
Актиномицин D, полипептидный антибиотик,
продуцируемый многими видами Streptomyces,
встраивается между двумя соседними парами оснований двухцепочечной ДНК (рис. 3.54). Он ингибирует все РНК-полимеразы, однако степень этого
ингибирования для разных ферментов существенно
различается. При концентрации актиномицина, приводящей к блокированию транскрипции, репликация ДНК не замедляется. Рифамицин, антибиотик
из Streptomyces mediterranei, или его синтетический
аналог рифампицин блокируют транскрипцию у
прокариот, но ни тот ни другой не влияют на
транскрипцию у эукариот. Эти соединения блокируют инициацию синтеза РНК, связываясь с β-субъединицами РНК-полимераза-холофермента. Но если синтез РНК уже иницирован, то процесс элонгации оказывается нечувствительным к рифампицину.
Другой антибиотик, применяемый для блокирования бактериальных РНК-полимераз,– стрептолиди-
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
161
L-метилвалин
Саркозин
L-пролин
D-валин
L-треонин
Феноксазоновое
кольцо
А
Б
Актиномицин D
РИС. 3.54.
Структура актиномицина D. А. Структурная
формула актиномицина D. Б. Трехмерное
изображение, в котором плоскость феноксазонового кольца перпендикулярна плоскости
страницы. В. Структура, изображенная на рис.
Б, интеркалирует (встраивается) между двумя
соседними
GC-парами дуплексной ДНК.
[S.С. Jain, Н.М. Sobell, J. Mol. Biol., 68 (1972),
P. 1.]
В
б. Ингибирование трансляции
гин из Streptomyces lydicus. Он блокирует элонгацию,
но не инициацию РНК.
Широко используемый ингибитор транскрипции
у эукариот – бициклический октапептид α-аманитин,
получаемый из гриба Amanita phalloides. Из трех
эукариотических РНК-полимераз (разд. 3.1.а) наиболее чувствительна к α-аманитину РНК-полимераза II. РНК-полимераза I не ингибируется совсем,
а РНК-полимераза III ингибируется только при высоких концентрациях антибиотика. Это соединение
очень удобно для разграничения ферментов, ответственных за транскрипцию конкретных видов РНК.
Здесь мы рассмотрим действие лишь некоторых
широко используемых антибиотиков – ингибиторов
трансляции как у про-, так и у эукариот (табл. 3.5
и 3.6).
Высокоосновный трисахарид стрептомицин, как
и большинство других аминогликозидов, связывается только с S12-белком 30S-субчастицы бактериальных рибосом. Одним из результатов такого связывания является подавление образования правильного комплекса инициации и тем самым блокирование
инициации синтеза полипептидной цепи. При связывании стрептомицина с 30S-субчастицей происходит
162
ЧАСТЬ I.
МОЛЕКУЛЯРНЫЕ ОСНОВЫ
Таблица 3.5. Ингибиторы белкового синтеза
у прокариот
Антибиотик
Действие
Стрептомицин
Связывается с 30S-субчастицей и
подавляет связывание
Met
Fmet-TPHKF с Р-участком;
вызывает ошибки в трансляции
Неомицин, канамицин
То же
Ингибирует пептидилтрансферазХлорамфеникол
ную активность 70S-рибосомы
Тетрациклин
Ингибирует присоединение аминоацетилированной тРНК к 30Sсубчастице
Эритромицин
Связывается со свободной 50Sсубчастицей и предотвращает
образование 70S-рибосомы; на
активную 70S-рибосому
не действует
Пуромицин
Вызывает преждевременную терминацию синтеза белка, действуя
как аналог аминоацил-тРНК
Фузидиевая кислота
Подавляет связывание аминоацилтРНК с А-участком, блокируя
высвобождение EF-G после
транслокации
Казугамицин
Подавляет связывание FmetтРНКFMet с Р-участком
Линкомицин
Ингибирует активность пептидилтрансферазы
Кирромицин
Связывается с EF-Tu, стимулирует
образование (EF-Tu)-GTP и
связывание тройного комплекса
с рибосомой, но подавляет
высвобождение EF-Tu
Тиострептон
Предотвращает транслокацию,
ингибируя EF-G
НАСЛЕДСТВЕННОСТИ: ОБЗОР
Следовательно, пуромицин индуцирует абортивную
терминацию синтеза полипептида.
Некоторые антибиотики (в том числе эритромицин из Streptomyces erythreus и фузидиевая кислота
из Fusidium coccineum) блокируют перемещение рибосомы после завершения элонгации или пептидилтрансферазную реакцию. В результате рибосома не
может переместиться к следующему кодону, пептидил-тРНК остается связанной с А-участком и блокируется взаимодействие со следующей аминоацилтРНК.
Хлорамфеникол и циклогексимид подавляют
один и тот же этап синтеза белковой цепи. Хлорамфеникол действует на рибосомы бактерий, митохондрий и хлоропластов, а циклогексимид – только
на рибосомы эукариот, находящиеся в цитоплазме.
Оба соединения влияют на пептидилтрансферазную
активность больших рибосомных субчастиц соответствующих рибосом, в результате чего элонгация
пептидной цепи блокируется, а А- и Р-участки оказываются занятыми.
Таблица 3.6. Ингибиторы белкового синтеза
у эукариот
Ингибитор
Действие
Абрин, рицин
Подавляет связывание аминоацилтРНК
Катализирует реакцию между
NAD и eIF-2 с образованием
неактивного фактора; подавляет
транслокацию
Ингибирует активность пептидилтрансферазы митохондриальных
рибосом
Вызывает преждевременную терминацию синтеза белка, действуя
как аналог аминоацил-тРНК
Подавляет транслокацию,
ингибируя eEF-2
То же
Ингибирует активность пептидилтрансферазы
Препятствует
локализации metтРНКIMet, на 40S-рибосоме
Подавляет образование комплекса
eIF-2-met-тPHKIMet-GTP
Подавляет транслокацию
Блокирует инициацию, индуцируя
фосфорилирование eIF-2
Дифтерийный токсин
также модификация структуры А-участка, что приводит к случайным неправильным спариваниям
между аминоацил-тРНК и кодонами. У мутантов
бактерий, устойчивых к стрептомицину, 30S-субчастицы изменены таким образом, что они либо не
способны к связыванию со стрептомицином, либо
если связывают его, то мешают его ингибирующему
действию. С рибосомами эукариот стрептомицин не
связывается и поэтому на их функцию не влияет.
Пуромицин из Streptomyces alboniger блокирует
синтез полипептидов на рибосомах как у про-, так
и у эукариот, имитируя действие аминоацил-тРНК
(рис. 3.55). Попав в клетку, пуромицин занимает
свободный А-участок, и его аминогруппа действует
как акцептор растущей полипептидной цепи, почти
аналогично аминогруппе связанной аминоацилтРНК. Поскольку взаимодействие с кодоном отсутствует, образовавшийся полипептидилпуромицин
отделяется от рибосомы, а рибосома – от мРНК.
Хлорамфеникол
Пуромицин
Фузидиевая кислота
Анизомицин
Циклогексимид
Пактамицин
Шовдомицин
Спарсомицин
Интерферон
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
163
РИС. 3.55.
Пуромицин имитирует аминоацил-тРНК и прерывает
элонгацию полипептидной цепи.
Пептидилпуромицин
3.10. СУДЬБА СИНТЕЗИРОВАННЫХ
БЕЛКОВ
Соединение аминокислот с образованием полипептидной цепи – это только первый шаг в процессе
формирования многих белков. Полипептидная цепь
должна быть уложена так, чтобы образовались
правильные вторичная и третичная структуры, а в
большинстве случаев отдельные полипептиды должны объединиться в функциональные олигомерные
комплексы. Являются ли эти процессы полностью
саморегулирующимися или протекают при участии
ферментов – пока неясно. До образования функционально активных белков первичные продукты трансляции часто претерпевают разные сложные изменения. Приведем несколько примеров таких изменений.
а. Посттрансляционная модификация
полипептидных цепей
Функционально активный гемоглобин образуется только после того, как α- и β-цепи объединятся
в α2β2-структуру и с боковыми группами аминокис-
Пуромицин
в А-участке
Пептидил-тРНК
в Р-участке
лот обеих субъединиц свяжется гемогруппа. Для
того чтобы пируваткарбоксилаза и ацетил-СоА-карбоксилаза стали активными ферментами, с определенными боковыми цепями их аминокислот должен
ковалентно связаться биотин. Некоторые белки,
участвующие в процессе свертывания крови, должны претерпеть карбоксилирование специфических
остатков глутаминовой кислоты, для того чтобы
образовались центры связывания Са 2 + . Для образования коллагена должно произойти гидроксилирование специфических пролиновых и лизиновых остатков. Очень важным и широко распространенным
способом регуляции метаболизма являются фосфорилирование и дефосфорилирование определенных
остатков серина, треонина и тирозина особыми
протеинкиназами и протеинфосфатазами соответственно. Многие протеолитические белки, участвующие в процессах пищеварения и свертывания крови,
синтезируются в виде крупных предшественников,
которые далее активируются путем отщепления участка полипептидной цепи. Инсулин синтезируется
в виде препроинсулинового полипептида и превращается в зрелый инсулин после расщепления цепи
и удаления сначала N-концевого, а затем внутренне-
164
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
В-цепь
Препроинсулин
РИС. 3.56.
Проинсулин
А-цепь
Инсулин
Превращение препроинсулина в инсулин. При трансляции инсулиновой мРНК образуется крупный предшественник - препроинсулин. Функциональный гормон, представляющий собой гетеродимер, образуется после отщепления N-концевого сигнального сегмента и расщепления молекулы проинсулина в двух местах, в результа-
те чего удаляется центральная часть (С) первичного
трансляционного продукта. Остающиеся А- и В-цепи
активного инсулина удерживаются вместе дисульфидными связями, образовавшимися в исходном полипептиде.
го сегмента (рис. 3.56). Многие вирусные белки,
гормоны, нейропептиды образуются из первичных
трансляционных продуктов полипротеинов – в результате расщепления по многим сайтам и образования нескольких зрелых белков и пептидов меньшего размера.
да такой информации и как она реализуется?
Сложный транспортный аппарат эукариотических клеток. Рибосомы в эукариотических клетках
существуют в двух состояниях: в свободном и связанном с мембранами. Белки, предназначенные для
некоторых органелл и цитозоля – водной фракции
цитоплазмы,– синтезируются на свободных рибосомах, а белки, остающиеся в лизосомах, структурах
Гольджи и плазматической мембране, образуются
на рибосомах, ассоциированных с эндоплазматическим ретикулумом (ЭР) – непрерывной сети внутриклеточных мембран, окружающих пространство, называемое просветом ЭР. Мембраны ЭР, с которыми
связаны рибосомы, называются шероховатым ЭР,
а мембраны, не связанные с рибосомами,– гладким
ЭР (рис. 3.57). Белки, синтезированные на рибосомах, связанных с ЭР, проходят через мембраны ЭР
в просвет ЭР, а «прокладывает» им путь N-концевой
участок (рис. 3.58). Затем этот участок, состоящий
преимущественно из гидрофобных аминокислот,–
сигнальная последовательность – отщепляется специфическими эндопептидазами, локализованными в
просвете ЭР. Такой направленный перенос белков
от рибосом в просвет ЭР начинается уже во время
б. Доставка эукариотических белков
к клеточным мембранам
и проникновение через них
В клетках эукариот помимо плазматических
мембран имеются разнообразные внутриклеточные
мембраны, отграничивающие различные клеточные
органеллы: митохондрии, хлоропласты (у растений), эндоплазматический ретикулум, аппарат Гольджи, пероксиомы, лизосомы и секреторные пузырьки
(везикулы) (рис. I.1, А). Каким образом белки, предназначенные для столь многочисленных клеточных
мембран и компартментов, попадают к месту своего назначения? Закодирована ли в белковой структуре информация об их внутри- или внеклеточной
локализации? Если да, то какова химическая приро-
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
165
Шероховатый
эндоплазматический
ретикулум
Гладкий
эндоплазматический
ретикулум
РИС. 3.57.
Электронная микрофотография среза печени крысы, на
которой видны гладкий и шероховатый эндоплазматический ретикулум (ЭР). Мембраны гладкого ЭР (слева
вверху) почти не содержат связанных рибосомных час-
тиц. Напротив, протяженные мембранные структуры
шероховатого ЭР (справа и внизу) усеяны рибосомами.
Крупные, более плотные структуры - митохондрии. (С
любезного разрешения George E. Palade.)
синтеза полипептидной цепи и поэтому называется
котрансляционным транспортом.
Направление синтезируемых полипептидных цепей в просвет ЭР. Транспорт мембранных и секретируемых белков в просвет ЭР опосредуется взаимодействием полипептидной сигнальной последовательности с сигнал-распознающей частицей (СРЧ)
и рецептором этой частицы (СРЧ-Р). Что заставляет
рибосому направиться к ЭР, если белок, который
она синтезирует, должен впоследствии секретироваться или транспортироваться в лизосомы или
плазматические мембраны? Несомненно, это зависит не от самой рибосомы. Белки цитозоля синтезируются на рибосомах, идентичных рибосомам, синтезирующим белки ЭР. В самом деле, рибосома,
в одном раунде синтезирующая белок цитозоля,
в следующем может синтезировать мембранный
белок. Попадание белка в ЭР происходит только
в результате взаимодействия СРЧ с сигнальной
последовательностью синтезируемой белковой цепи
(рис. 3.59). Комплекс «СРЧ – сигнальная последовательность» взаимодействует впоследствии с рецептором СРЧ, локализованным в мембране ЭР. Таким
образом, СРЧ служит адаптером между аппаратом
синтеза белка в цитоплазме и аппаратом его доставки и отвечает за попадание белков в просвет
ЭР. СРЧ связывается с сигнальной последовательностью сразу после выхода ее из рибосомы, т.е.
после синтеза сегмента длиной примерно 70 амино-
кислот. Элонгация полипептидной цепи замедляется
до тех пор, пока комплекс СРЧ – сигнальная последовательность не свяжется с СРЧ-Р в мембране ЭР.
Сразу после этого СРЧ отделяется, скорость синтеза
полипептидной цепи увеличивается и растущая полипептидная цепь протягивается сквозь мембрану
в просвет. Итак, ассоциация транслирующей рибосомы с СРЧ-Р приводит к однонаправленному переносу растущей полипептидной цепи в просвет ЭР.
Особая пептидаза, локализованная в просвете ЭР,
осуществляет специфическое отщепление сигнальной последовательности от новосинтезированного
белка.
СРЧ представляет собой комплекс из шести белков с мол. массами от 10000 до 75000 Да и единственной молекулы РНК длиной 300 нуклеотидов –
7SL-PHK. Ни РНК, ни белки сами по себе не могут
функционировать как СРЧ. Однако при смешивании
РНК и белков in vitro образуется функциональная
СРЧ. В таких экспериментах молекулы 7SL-PHK из
клеток млекопитающих, амфибий и насекомых могут образовать СРЧ с белками млекопитающих.
Этот факт наряду с данными о близости нуклеотидных последовательностей 7SL-PHK из этих источников говорит о том, что структура 7SL-PHK эволюционно консервативна. Состоит ли роль 7SL-PHK
в прямом узнавании сигнальной последовательности или она служит каркасом для сборки разных
белковых субъединиц в функциональной СРЧ, а воз-
40S
60S
Мембраны ЭР
Просвет ЭР
С-концевой
якорь
167
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
РИС. 3.58.
Котрансляционный транспорт полипептидных цепей.
Полипептиды, синтезируемые на рибосомах шероховатого ЭР, направляются через мембраны в просвет ЭР.
Гидрофобный N-концевой участок нового белка - сигнальная последовательность - проходит через мембрану
вскоре после начала трансляции и по мере элонгации
полипептида выходит в просвет ЭР. Синтезированные
белковые молекулы подвергаются в ЭР различным модификациям в зависимости от их окончательной судьбы, однако все они утрачивают свою сигнальную последовательность. N' - это новый N-конец, образующийся
после отщепления сигнальной последовательности. На
верхнем рисунке сигнальная последовательность заякорена в мембране; она отщепляется по завершении
трансляции, и полипептид с новым N-концом оказывается в просвете ЭР. На среднем рисунке сигнальная
последовательность отщепляется еще до завершения
трансляции; С-конец синтезированного полипептида
заякорен в мембране ЭР. На нижнем рисунке сигнальная последовательность отщепляется сразу после попадания полипептида в просвет ЭР.
можно, и то и другое,– пока неизвестно.
Сигнальная последовательность обычно находится на N-конце белков, предназначенных для экспорта к одной из клеточных мембран или внутриклеточным органеллам. В некоторых случаях, однако, аминокислотная последовательность, узнаваемая СРЧ, не является ни N-концевой, ни отщепляемой от транспортируемого белка, а отдельные секретируемые белки не содержат вообще никакой
сигнальной последовательности.
Длина сигнальной последовательности колеблется от 15 до 35 аминокислот, и в первых трех ее
четвертях преобладают гидрофобные остатки (рис.
3.60), однако никакой консервативной аминокислотной последовательности этот участок не имеет. Для
узнавания сигнальной последовательности СРЧ скорее важна ее вторичная структура. Интересно, что
сигнальные последовательности белков эукариот
узнаются аппаратом транслокации бактерий, а сигнальные последовательности секретируемых бактериями белков могут проникать через мембранные
компоненты эукариотических клеток.
В пределах сигнальной последовательности находится также и сайт, распознаваемый сигнальной
пептидазой. Обычно расщепление происходит со
Рибосома
Сигналраспознающая
частица (СРЧ)
Рецептор СРЧ
Мембрана ЭР
Просвет ЭР
РИС. 3.59.
Перенос синтезированного полипептида в ЭР опосредуется сигнал-распознающей частицей (СРЧ). Показано,
как СРЧ связывается с N-концевой сигнальной последо-
Свободный белок
в просвете ЭР
вательностью растущей полипептидной цепи и затем
с СРЧ-рецептором в мембране ЭР, в результате чего
пептид проникает в просвет ЭР.
168
РИС. 3.60.
Характерные сигнальные последовательности, находящиеся на N-конце некоторых прокариотических и эукариотических белков. В начале этих последовательностей
имеется короткий участок из одной или более заряжен-
Пролактин
Гликопротеин вируса
везикулярного стоматита
Лизоцим
Мальтозосвязывающий
белок
Лейцинсвязывающий белок
Проальбумин
Легкая цепь IgG
Основной белок
оболочки фага td
Щелочная фосфатаза
β-Лактамаза
Белок
Липопротеин
pBR322
Заряженный участок
Гиброфобный участок
ных аминокислот, а за ним следует гидрофобный сегмент. [S. Michaelis, J. Beckwith, Ann. Rev. Microbiol., 36
(1982), p. 435; D.P. Leader, Trends Biochem. Sci., 4
(1979), p. 205.]
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
A
Секреторные везикулы,
выходящие с транс-стороны
Цистерны
Гольджи
Б
РИС. 3.61.
Транспортные везикулы,
отделяющиеся от
шероховатого ЭР
Аппарат Гольджи. А. Электронная микрофотография
экзокринных клеток поджелудочной железы крысы, на
которой видны примыкающие к ЭР цистерны аппарата
Гольджи. Цистерны, расположенные ближе к ЭР, называются цис-цистернами, а дальше - транс. Видны везикулы, отпочковывающиеся от элементов ЭР. [Е.М. Меrisko, M. Fletcher, G. Palade, Pancreas, 1 (1986), p. 95.
С любезного разрешения M.G. Farquhar.] Б. Схематическое изображение цистерн и везикул аппарата Гольджи. [J. Darnell, H. Lodish, D. Baltimore, Molecular Cell
Biology (New York: Scientific American Books, 1986)
и в соответствии с моделью J. Kephart]
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
169
Клеточная мембрана
Цитозоль
Транс-поверхность
Просвет
аппарата
Гольджи
Цис-поверхность
Транспортные
везикулы
Рибосомы
Просвет
ЭР
Ядро
Оболочка
РИС. 3.62.
Транспортные везикулы, содержащие полипептиды, которые должны попасть в лизосомы, плазматические
мембраны или секретироваться, отделяются от ЭР и
сливаются с цис-поверхностью аппарата Гольджи. Полипептиды проходят через аппарат Гольджи в составе
этих везикул и выходят в цитозоль через транс-поверх-
ность в составе транспортных везикул, отделяющихся от
цистерн Гольджи. Во время прохождения полипептидов
через структуры аппарата Гольджи они претерпевают
такие посттрансляционные модификации, как протеолитическое расщепление и гликозилирование.
стороны С-конца остатков глицина, серина или
аланина, поэтому N-конец многих зрелых секретируемых или мембранных белков соседствует с одной
из этих аминокислот в сигнальной последовательности.
Транспорт белков от ЭР к аппарату Гольджи
и из него. Белки направляются к лизосомам, плазматическим мембранам или секретируются с помощью аппарата Гольджи – набора тесно упакован-
ных, взаимопроникающих, окруженных мембранами цистерн (рис. 3.61). Перенос белков к аппарату
Гольджи осуществляется с помощью так называемых окаймленных пузырьков (везикул), отпочковывающихся от ЭР и сливающихся с цистернами
Гольджи (рис. 3.62). Белки проходят через аппарат
Гольджи от цис-цистерн к транс. Транспорт белков
через цистерны также осуществляется с помощью
окаймленных транспортных везикул.
170
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Шероховатый ЭР
Гольджи
цис
Долихол
РИС. 3.63.
транс
N-ацетилглюкозамин
Манноза
Глюкоза
Галактоза
Фукоза
Сиаловая кислота
Фосфат
Гликозилирование белков в шероховатом ЭР и цистернах Гольджи. В ЭР разветвленный олигосахарид, связанный с липидом долихолом с помощью пирофосфатного мостика, переносится на аспарагиновый остаток
белка в последовательности asn-x-ser или asn-x-thr (где
х - любая аминокислота). Затем N-связанный олигосахарид модифицируется в результате последовательных
специфических гликозилгидролазных и гликозилазных
реакций, протекающих либо в ЭР, либо в то время, когда
белок проходит через аппарат Гольджи. Разные белки
содержат различные N-связанные олигосахариды в зависимости от первичной и вторичной структуры белка,
а также от наличия или отсутствия специфических ферментов, осуществляющих процессинг олигосахаридов
в клетках [J. Darnell, H. Lodish, D. Baltimore, Molecular
Cell Bioilogy (New York: Scientific American Books,
1986).]
Белки, предназначенные для секреции, сначала
попадают в секреторные везикулы, которые в конце
концов сливаются с плазматическими мембранами
и высвобождают свое содержимое наружу. Когда
секреция белков индуцируется (как в случае инсулина или некоторых нейропептидов), цитозольные секреторные пузырьки сливаются с мембраной и высвобождают содержимое наружу только после индукции. Как окаймленные везикулы различают белки, предназначенные для того или иного клеточного
компартмента, неясно. Неизвестно также, различаются ли между собой везикулы, несущие разные
белки, и если различаются, то чем именно.
Гликозилирование. Проходя через ЭР и аппарат
Гольджи, белки подвергаются интенсивной модификации (рис. 3.63). Специальный фермент ЭР присоединяет разветвленный олигосахарид к специфическим аспарагиновым остаткам транспортируемых
белков. Далее олигосахарид подвергается действию
целого ряда специфических гликозилгидролаз и гликозилированию; эти реакции протекают в ЭР и в
то время, когда белки проходят через аппарат
Гольджи.
в. Транспорт белков
в эукариотические клеточные
органеллы
Не все белки, направляемые к внутриклеточным
органеллам, следуют маршрутом, включающим ЭР
и аппарат Гольджи. Большинство белков митохондрий, ядер, хлоропластов растений синтезируются на
свободных цитоплазматических рибосомах либо
сразу в виде зрелых форм, либо в виде предшественников и затем подхватываются соответствующими органеллами. Остальные белки митохондрий
и хлоропластов кодируются ДНК, содержащейся
в этих органеллах, и синтезируются с помощью
аппарата трансляции этих органелл аналогично тому, как это происходит в цитоплазме.
Митохондрии, например, имеют несколько компартментов: матрикс, наружную мембрану и межмембранное пространство (рис. 3.64). Белки, кодируемые ядерной ДНК, которые должны быть
локализованы в матриксе, синтезируются в виде
предшественника и содержат от 25 до 60 лишних
аминокислот на N-конце. После связывания с рецептором на наружной мембране предшественник
транспортируется в этот внутренний матрикс. Движущей силой процесса является электрохимический
171
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
потенциал на внутренней мембране, генерируемый
с помощью энергетически выгодных реакций, протекающих в митохондрии. Одновременно с переносом
или сразу после него лишние аминокислоты на
N-конце удаляются специфическими протеазами,
находящимися в матриксе. Некоторые белки остаются во внутренней мембране, а другие проходят
сквозь мембрану и попадают в матрикс. Белки,
синтезированные в цитозоле и направленные в межмембранное пространство митохондрий, переносятся несколькими способами (рис. 3.64). Некоторые
предшественники содержат особый N-концевой сегмент и попадают в митохондрии так, как это было
описано выше. У других предшественников отщепление концевой последовательности приводит к тому, что белки остаются временно встроенными во
внутреннюю мембрану; затем следующий процессирующий фермент расщепляет этот промежуточный
продукт, и зрелый белок выходит в межмембранное
пространство. Белки, локализуемые в наружной
мембране, транспортируются энергонезависимым
путем и без превращения предшественника в зрелый
белок. В некоторых случаях переносу цитозольного
белка в наружную мембрану способствуют конформационные изменения белковой молекулы при связывании простетической группы. Белки закрепляютНаружная
мембрана
митохондрий
Цитозоль
Внутренняя
мембрана
митохондрий
Белок, включающийся во
внутреннюю мембрану
Межмембранный
белок
Матриксный белок
Белок, включающийся
в наружную мембрану
РИС. 3.64.
Спонтанная
реакция
Включение белков в митохондрии. В зависимости от
конечной локализации митохондриальных белков (она
указана слева) последние используют тот или иной
способ транспортировки и подвергаются разным модификациям.
172
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
ся в мембранах с помощью якорных последовательностей, которые проникают в липидный бислой;
подобные последовательности могут находиться и
на амино-, и на карбокси-конце, и даже в середине
полипептидной цепи.
г. Транспорт белков
в клетках прокариот
И про-, и эукариотические клетки имеют пограничные липопротеиновые мембраны. Внутренняя
мембрана бактериальных клеток отделяет цитоплазму от межмембранного, или периплазматического, пространства. Наружная мембрана отделяет периплазматическое пространство от внешней среды.
Новосинтезированные белки бактерий должны распределяться между цитозолем, внутренней (плазматической) мембраной, межмембранным пространством, наружной мембраной и внешней средой. Как
и у эукариот, у бактерий белки, направляемые в
плазматическую мембрану или более отдаленные
места, отличаются от белков, остающихся в цитозоле, тем, что имеют сигнальную последовательность
на N-конце (рис. 3.60). Эта последовательность тоже
отщепляется с образованием зрелых форм белков
внутренней мембраны или межмембранного пространства. Однако в отличие от эукариотических
мембранных белков бактериальные аналоги не гликозилируются. Мембранные белки бактерий тоже
транспортируются через внутреннюю мембрану путем котрансляционного переноса. Направляется ли
сигнальная последовательность к внутренней мембране с помощью некой нуклеопротеиновой частицы,
как у эукариот, или в результате прямого контактирования гидрофобного конца с мембраной – неизвестно. В любом случае образующаяся полипептидная цепь протягивается через внутреннюю мембрану по мере синтеза. Связанная с мембраной сигнальная протеаза отщепляет сигнальную последовательность, и зрелый белок остается заякоренным в
мембране или находится в свободном состоянии
в периплазме. Векторный перенос некоторых прокариотических белков через мембраны может произойти и посттрансляционно; в этом случае движущей силой переноса также служит трансмембранный потенциал. При имеющемся сходстве в процессах транспорта у про- и эукариот неудивительно,
что белки, экспортируемые из бактериальных клеток, могут экспортироваться также из эукариотических клеток, и наоборот. Неудивительно и то, что
если к цитозольному белку искусственно пришить
соответствующую сигнальную последовательность,
то он сможет транспортироваться к мембране или
даже пройти сквозь нее в зависимости от своей
вторичной структуры.
3.11. РЕГУЛЯЦИЯ ГЕННОЙ
ЭКСПРЕССИИ
Основным свойством как про-, так и эукариот
является их способность осуществлять дифференциальную регуляцию экспрессии генов. Осуществляя контроль за тем, каким генам экспрессироваться, а каким нет, а также регулируя уровень
экспрессии различных генов, клетки приспосабливают свой фенотип к определенным условиям внешней и внутренней среды. Часто гены экспрессируются последовательно: активация одного гена вызывает экспрессию другого или нескольких генов, приводя в конечном счете к каскаду событий. Некоторые гены или родственные группы генов экспрессируются координированно, т.е. отвечают на регуляторный сигнал одновременно и, как правило,
в одинаковой степени. Вероятно, наиболее совершенные регуляторные системы – те, которые позволяют плюрипотентным стволовым клеткам дифференцироваться с образованием клеток разного типа
в процессе развития сложного организма.
Фенотипические признаки клеток разных типов,
а также одной и той же клетки в различных условиях зависят от количества и свойств продуцируемых ими структурных, каталитических и регуляторных белков. Регулироваться может какой-то
один или несколько отдельных этапов считывания
генетической информации при синтезе белка. У бактерий, например у Е. coli, образование белков регулируется главным образом содержанием мРНК,
доступной для трансляции. Дополнительный способ
поддержания нужной концентрации клеточных белков состоит в регуляции различных этапов трансляции, а также скорости деградации белков. Эукариотические клетки обладают более сложными механизмами регуляции белкового состава. Содержание мРНК в цитоплазме регулируется не только
на уровне инициации транскрипции в ядре, но
и на уровне процессинга первичных транскриптов
и транспорта зрелых РНК в цитоплазму. Подобно
прокариотам, эукариотические клетки тоже могут
регулировать как трансляцию, так и скорость
транспорта и деградации белков.
В этом разделе мы на нескольких примерах
проиллюстрируем механизмы регуляции генной
экспрессии, используемые прокариотами, в частности Е. coli и ее бактериофагами. Более сложные
механизмы регуляции у эукариот обсуждаются в гл. 8.
а. Регуляция содержания РНК
в процессе биосинтеза
Образование РНК у прокариот чаще всего регулируется на уровне инициации транскрипции несколькими способами. Первый заключается в мо-
173
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
дификации структуры РНК-полимеразы. Так, бета(или бета-прим) субъединица РНК-полимеразы
Е. coli изменяется при заражении клеток некоторыми
бактериофагами. Другой пример – образование новой, сигма-субъединицы при споруляции определенных штаммов Bacillus. И в том и другом случае
изменяются способность РНК-полимеразы к связыванию с промотором и скорость транскрипции
соответствующих генов. Второй способ регуляции
заключается в изменении пространственной структуры ДНК, что влияет на способность РНК-полимераз связываться с определенными промоторами и инициировать синтез РНК. И наконец, взаимодействие РНК-полимеразы с некоторыми промоторами может ингибироваться или стимулироваться
белками, которые связываются с ДНК в месте
присоединения полимеразы или вблизи него. На
связывание таких регуляторных белков – репрессоров
и активаторов часто влияют определенные метаболиты, играющие роль корепрессоров и коактиваторов.
Скорость элонгации РНК зависит также от вторичной структуры мРНК. Сигналы, которые определяют, дойдет ли транскрипция до конца или
закончится преждевременно, играют ключевую
роль в регуляции уровня мРНК. В подобных случаях за прекращение или продолжение транскрипции отвечают определенные нуклеотидные последовательности и белки.
Вторичная структура транскриптов может также
влиять на их стабильность, при этом особую роль
в определении продолжительности жизни РНК
в клетке играет структура 3'-конца. Одни мРНК
очень стабильны и участвуют во многих циклах
трансляции. Другие, наоборот, быстро разрушают-
ся уже в процессе трансляции. Контроль на уровне
транскрипции особенно важен в случае наименее
стабильных мРНК. Как уже указывалось, зрелые
молекулы рРНК и тРНК – это продукты процессирования первичных транскриптов (разд. 3.3).
Посттранскрипционные события в свою очередь
тоже регулируются, и от них зависит содержание
в клетке функциональных молекул РНК.
б. Согласованная регуляция
экспрессии прокариотических генов
Согласованная регуляция групп родственных генов. У Е. coli гены, кодирующие белки одного и того
же метаболического пути или определяющие близкородственные функции, часто регулируются согласованно. Это значит, что их экспрессия начинается
и заканчивается или согласованно продолжается
в ответ на один и тот же регуляторный сигнал.
Гены, подчиняющиеся согласованной регуляции,
в геноме часто бывают сцеплены и транскрибируются с промотора, находящегося на 5'-конце такой группы генов (кластера), в виде единственной
молекулы РНК, называемой полицистронным (или
полигенным) гранскриптом. Группа координированно экспрессирующихся генов называется опероном. Три гена, кодирующие ферменты, ответственные за метаболизм галактозы у Е. coli, организованы в оперон с промотором (Р) и примыкающим
к нему регуляторным сегментом – оператором (О)
на 5'-конце транскрибируемой последовательности:
gal E-gal T-gal K (рис. 3.65). Синтез ферментов, необходимых для утилизации арабинозы, регулируется
двумя сопряженными транскрипционными единица-
Галактозный оперон
gal-мРНК
gal R
О
P
gal E
gal T
gal K
gal-Peпpeccop
UDP-глюкоза
UDP-галактоза
Галактозо-1-Р
ADP
Глюкозо-1-Р
РИС. 3.65.
Галактозный оперон (gal) E. соli. Представлены оператор (О), промотор (Р) и три гена оперона - gal Е, gal T
и gal К. Внизу показаны реакции, катализируемые тремя
генными продуктами - галактокиназой, уридилтрансфера-
Галактоза
UDP-глюкоза
АТP
зой и UDP-галактозоэпимеразой. Все три фермента
транслируются
с
единственной
полицистронной
gal-мРНК. Ген gal R, кодирующий репрессор galоперона, не сцеплен с опероном.
174
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Арабинозный оперон
аrа BAD-мРНК
аrа С-мРНК
аrа С
аrа В
аrа А
аrа D
ara-Репрессор
и активатор
L-арабинозоизомераза
L-арабиноза
L-рибулозо-4эпимераза
L- рибулокиназа
L-рибулоза
L-рибулозо-5-Р
D-ксилулозо-5-Р
ADP
АТР
РИС. 3.66.
Арабинозный оперон (аrа) E. соli и примыкающий к
нему ген аrа С. Транскрипция этих двух единиц осуществляется в противоположных направлениях. Они
ми (рис. 3.66). Первая – это аrа-оперон, состоящий
из трех генов, ara В, аrа А и аrа D, и некоего 5'-контролирующего участка. Вторая представлена геном
ara С, кодирующим регуляторный белок, необходимый для транскрипции аrа-оперона.
Гены, кодирующие несколько родственных функций, не всегда образуют единый оперон. Так, гены,
кодирующие 30S- и 50S-рибосомные белки, организованы во множественные опероны, в чей состав
иногда входят гены, кодирующие другие белки,
которые участвуют в транскрипции и/или трансляции (рис. 3.67). Гены, продукты которых необходимы для синтеза аргинина, также разбросаны по
нескольким генетическим локусам, и только один
кластер генов (аrg ЕСВН) представлен типичным
опероном. Как правило, отдельные опероны, кодирующие родственные функции, имеют одинаковые
или сходные регуляторные последовательности
и поэтому реагируют на определенный регуляторный сигнал сходным образом.
Позитивная и негативная регуляция. Негативная
регуляция инициации транскрипции, или репрессия,
осуществляется белками-репрессорами, которые
связываются с операторами. Поскольку последовательности оператора и промотора часто перекрываются, связывание репрессоров со своими операторами ограничивает доступ РНК-полимеразы
к промотору, подавляя тем самым инициацию
транскрипции. Позитивная регуляция может осу-
имеют собственные промоторы и операторы: ОC и РC
для аrа С и OBAD и PBAD для аrа-оперона.
ществляться путем связывания специфических белков с нуклеотидными последовательностями,
расположенными в области промотора. Считается,
что связанный активаторный белок способствует
ассоциации РНК-полимеразы с промотором и, следовательно, увеличивает вероятность инициации
транскрипции.
Гены, кодирующие регуляторные белки, которые
связываются с операторными или активаторными
последовательностями, могут находиться как вблизи контролируемых ими генов, так и далеко от них.
Например, ген, кодирующий репрессор галактозного оперона (galR), не сцеплен с транскрипционной
единицей, состоящей из генов gal E, gal Т и gal К
(рис. 3.65). Напротив, позитивная или негативная
регуляция транскрипции арабинозного оперона зависит от того, образуется или нет комплекс между
арабинозой и белком, кодируемым только сцепленным с опероном геном аrаС (рис. 3.66).
в. Регуляция экспрессии лактозного
оперона
Негативная регуляция. Бактерии Е. coli могут
использовать в качестве единственного источника
углерода и энергии лактозу, поскольку они способны образовывать в большом количестве β-галактозидазу – фермент, расщепляющий лактозу на глюкозу и галактозу. Однако при росте на других источни-
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
РИС. 3.67.
Положение на генетической карте Е. coli генов, кодирующих рибосомные белки. Белки субчастиц 30S и 60S
обозначены соответственно S и L. На карте указаны
также позиции генов, кодирующих субъединицы α, β, β'
и δ РНК-полимеразы; ДНК-праймазу (dna G) и тРНКметилтрансферазу (trm D). G, Tu и Ts - факторы трансляции EF-G, EF-Tu и EF-Ts соответственно. Направление
транскрипции (там, где оно известно) показано стрелками.
ках углерода в клетках Е. coli образуется очень
мало β-галактозидазы. Ген, ответственный за синтез
β-галактозидазы (lac Z), называется индуцибельным,
поскольку кодируемый им фермент синтезируется
только тогда, когда в клетке присутствуют сахара,
имеющие β-галактозильные остатки. Помимо β-галактозидазы, β-галактозиды индуцируют образование еще двух белков: β-галактозидпермеазы (кодируемой геном lac Y), необходимой для проникновения β-галактозидов в клетку, и β-галактозидтрансацетилазы (lас А), фермента с невыясненной пока
функцией (рис. 3.68). В этих трех генах – lас Z, lac Y
и lаc А – содержится вся информация о белках, кодируемых lас-опероном. Они транскрибируются в единую полицистронную РНК, при трансляции которой образуются почти одинаковые количества соответствующих белков. Поэтому можно сказать, что
три гена lас-оперона экспрессируются согласованно.
Со структурными генами lас-оперона связаны
несколько типов регуляторных элементов, ответст-
175
венных за индуцибельность и координированную
регуляцию этих генов (рис. 3.68). Промотор – это
нуклеотидная последовательность, с которой связывается РНК-полимераза и начинается транскрипция трех структурных генов. Оператор – это сайт,
с которым связывается lас-репрессор, подавляющий
транскрипцию lас-оперона. Ген lac I, не входящий
в состав lас-оперона, кодирует репрессор – полипептидную цепь с мол. массой 37000 Да. Репрессор
прочно связывается с оператором, находясь в тетрамерной форме.
Поскольку промоторная и операторная последовательности перекрываются, связывание репрессора с оператором мешает связыванию РНК-полимеразы с промотором, что приводит к блокированию транскрипции структурных генов. Транскрипцию оперона можно индуцировать, если блокировать связывание репрессора с оператором
(рис. 3.69). Такое блокирование происходит при связывании одного из β-галактозидов с той или иной
субъединицей репрессора, что уменьшает сродство
последнего к оператору. После отсоединения репрессора от промотра полимераза может связаться
с промотором и инициировать транскрипцию оперона.
Очень важно сохранение нуклеотидной последовательности домена lас-оператора, связывающего
репрессор. Об этом свидетельствуют результаты
исследования эффективности репрессии in vivo
у мутантов с модифицированными репрессорами
или операторами (рис. 3.70). Интересные данные
были получены и при изучении связывания очищенных репрессорных белков с операторами дикого
типа и мутантными формами in vivo. Мутации,
уменьшающие сродство репрессора к оператору,
приводили к конститутивному синтезу ферментов,
кодируемых lас-опероном, т.е. к экспрессии lас-ферментов в отсутствие индуктора. Мутации, сопровождающиеся накоплением репрессора в клетках
или увеличением сродства репрессора к оператору,
делали laс-оперон неиндуцибельным.
Позитивная регуляция. Для экспрессии lас-оперона, как и других индуцибельных оперонов, которые осуществляют контроль синтеза ферментов,
участвующих в метаболизме сахаров, необходимо
не только снять репрессию оперона, но и получить
некий сигнал. Таким сигналом служит комплекс
циклического AMP (cAMP) с белком-активатором
катаболизма (САР, от англ. catabolite activator
protein), который связывается со специфической
последовательностью, находящейся в самом начале
lас-промотора (рис. 3.71). сАМР, принимающий
участие во многих клеточных процессах, образуется
из АТР (рис. 3.72) в ответ на самые разные внеи внутриклеточные события. САР представляет собой димер из идентичных полипептидных цепей
176
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 3.68.
Репрессор
Промотор
и оператор
Структурные гены
мРНК
laс-репрессора
lас-Репрессор
РИС. 3.69.
Лактозный оперон Е. соli (lас) и тесно сцепленный с ним
ген lac-репрессора (lac I).
lас-мРНК
β-Галактозидаза
Репрессия laс-оперона гомотетрамерным laс-репрессором (вверху) и
индукция laс-оперона после связывания с репрессором β-галактозидного
индуктора (внизу).
β-Галактозидпермеаза
Субъединица
lас-репрессора
β-Галактозидтрансацетилаза
lac-Репрессор связывается
с участком Р–О и блокирует
присоединение РНК-полимеразы
и транскрипцию
Активный
lас-репрессор
Неспособен связываться
с участком Р–О
Активный
lac-репрессор
β-Галактозид
Неактивный
lac-репрессор
РИС. 3.70.
Нуклеотидная последовательность lас-операторного участка, связывающегося с репрессором.
Внизу указаны замены пар оснований, понижающие эффективность связывания репрессора с
оператором. Стрелками показаны инвертированные повторы. Наличие таких повторов характерно
для операторных последовательностей E. соli.
[J.D. Watson et al., Molecular Biology of the Gene,
4 th ed. (Menlo Park, Calif.: Benjamin/Cummings,
1987).]
Замены, понижающие
эффективность
связывания
177
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Промотор
lacI
Область связывания
САР-сАМР
Место присоединения
РНК-полимеразы
–35
Участок, занимаемый
САР-сСАМР
Оператор
–10
мРНК
Участок,
занимаемый
репрессором
Участок, занимаемый РНК-полимеразой
РИС. 3.71.
lacZ
Инициация
трансляции
Нуклеотидные последовательности, принимающие участие в регуляции экспрессии laс-оперона: область связывания с репрессором, –10- и –35-участки промотора
и область связывания комплекса белка-активатора катаболизма и сАМР (САР-сАМР).
с мол. массой 22 кДа. Связывание комплекса
САР-сАМР со специфической последовательностью
в начале промотора приводит к усилению транскрипции lас-оперона почти в 50 раз. Сам по себе
САР не способен к такому связыванию и стимуляции транскрипции. Усиление транскрипции с помощью
комплекса САР-сАМР можно объяснить тем, что,
связываясь с ДНК в непосредственной близости от
сайта присоединения РНК-полимеразы, он усиливает сродство этого фермента к промотору (рис. 3.73).
Альтернативная гипотеза заключается в том, что
связывание САР-сАМР с САР-сайтом предотвращает присоединение РНК-полимеразы к расположенному поблизости слабому промотору и увеличивает тем самым вероятность того, что полимераза свяжется с «правильным» промоторным сайтом.
Высказывавшееся ранее предположение, что комплекс САР-сАМР изменяет топологию ДНК, так что
облегчаются связывание полимеразы и транскрипция, кажется несостоятельным.
Комплекс САР-сАМР является положительным
сигналом при регуляции экспрессии и других оперонов, в частности тех, которые кодируют ферменты расщепления углеводов. Например, для экспрессии аrа- и gal-оперонов должны произойти
дерепрессия с помощью индукторов – арабинозы
и галактозы соответственно – и связывание комплекса САР-сАМР с областью промотора. Так, у бактерий, растущих на глюкозе, уровень внутриклеточного сАМР и соответственно комплекса САР-сАМР
очень низок. Поэтому, если даже в среде присутствует арабиноза или галактоза, в клетках не образуются ферменты, необходимые для утилизации
этих сахаров. При уменьшении количества глюкозы
уровни сАМР и САР-сАМР увеличиваются и опероны в присутствии необходимых индукторов начинают экспрессироваться. Подобная комбинация позитивной и негативной систем регуляции очень важна, поскольку это предотвращает образование ферментов, потребность в которых в данный момент
отсутствует. Сигнальная система САР-сАМР регулирует также работу оперонов, кодирующих ферменты, которые участвуют в деградации аминокислот, пуринов и пиримидинов. Накопление в клетке
САР-сАМР служит сигналом «голодания»: в ответ
на него снижается экспрессия оперонов, кодирующих ферменты расщепления аминокислот, пуринов
3'-5'-циклический AMP (сАМР)
Аденилатциклаза
АТР
РИС. 3.72.
Неорганический пирофосфат
Синтез циклического AMP (сАМР) из АТР катализируется аденилатциклазой.
РИС. 3.73.
Модель, иллюстрирующая влияние связывания САРсАМР со своим участком на присоединение РНК-полимеразы к laс-промотору. Предполагается, что САР и холополимераза взаимодействуют друг с другом.
178
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
и пиримидинов. В этом случае логика работы системы также состоит в том, чтобы предотвратить
образование ненужных ферментов в период голодания.
г. Регуляция экспрессии
триптофанового оперона
Триптофан синтезируется в Е. coli из ароматического предшественника – хоризмовой кислоты – в
ходе пяти последовательных реакций, катализируемых ферментным комплексом из пяти белков
(рис. 3.74). Эти кодируемые trp-опероном белки
образуются согласованно, примерно в равных количествах, при трансляции полицистронной мРНК
длиной 7000 нуклеотидов, транскрибируемой с промотора. При наличии в среде достаточного для
роста бактерий количества триптофана клетки
Е. coli образуют ферменты биосинтеза триптофана
в очень малых количествах. Однако если клетки
лишены экзогенного триптофана, то в них начинается довольно интенсивный синтез всех пяти ферментов. Содержание ферментов этой группы в клетках Е. coli может различаться до 700 раз в зависимости от внутриклеточного уровня триптофана.
Подобный разброс в уровне экспрессии обусловлен наличием двух практически независимых механизмов регуляции, каждый из которых «подгоняет»
уровень синтеза trp-мРНК к концентрации внутриклеточного триптофана. Один механизм основан на
репрессии, изменяющей эффективность инициации
транскрипции в промоторе. Второй называется
аттенуацией и регулирует транскрипцию с помощью
сигнала терминации транскрипции, расположенного
между промотором и началом первого структурного гена (рис. 3.74). Эффекты этих двух регуляторных механизмов комплементарны, мультипликативны и позволяют увеличивать степень экспрессии оперона. Мы обсудим в этом разделе оба
способа регуляции и их вклад в гармоничный процесс биосинтеза триптофана.
Репрессия триптофанового оперона. Транскрипция trp-oпepoнa блокируется, когда репрессор связывается с последовательностью trp-оператора. Ген
trp R, кодирующий репрессорный белок мол. массой
58000 Да, находится далеко от trp-оперона. Для
того чтобы trp R-белок мог связаться с оператором
и действовать как репрессор, он должен образовать
комплекс с триптофаном. Поскольку уровень экспрессии trp R очень низок и не зависит от триптофана, концентрация активного репрессора отражает концентрацию внутриклеточного триптофана.
Нуклеотидные последовательности trp-оператора и промотора перекрываются (рис. 3.75), поэтому
связывание комплекса репрессор-триптофан с оператором препятствует правильному взаимодейст-
мРНК trp-оперона
trp-Лидерная мРНК
Промотор
Аттенуатор
trpD
trpE
trpL
trpC
trpB
trpA
Оператор
Терминация
транскрипции
Терминация
Начало
транскрипции транскрипции
Антранилатсинтаза,
Антранилатсинтаза,
компонент I
компонент II —
PR-антранилаттрансфераза
(Col) 2 (Co ll)2
Хоризмат
РИС. 3.74.
Антранилат
+ L-глутамин
PR-антранилат
+ PRPP
Триптофановый оперон E. coli (trp-оперон). Указаны
генные продукты и катализируемые ими реакции по
превращению хоризмовой кислоты в триптофан. Пять
генных продуктов дают четыре фермента. Представлены
лидерная последовательность trp L и ее транскрипт
Триптофан- ТриптофанPR-антранилатизомераза— синтетаза β синтетаза α
индолглицеролфосфатсинтетаза
α2β2
CdRP-
InGP
L- триптофан
+ L-серин
(trp-лидерная РНК), а также аттенуатор и полицистронная мРНК trp-оперона. Сокращения: PR - фосфорибозил, PRPP - фосфорибозилпирофосфат, CdRP - карбоксифениламинодезоксирибулозофосфат и lnGP - индолглицерофосфат. (С любезного разрешения С. Yanofsky.)
179
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Область связывания РНК-полимеразы
–40
–30
Промотор
–20
–10
Оператор
РИС. 3.75.
+1
+10
Начало синтеза мРНК
Перекрывающиеся нуклеотидные последовательности
промотора и оператора trp-оперона Е. соli. Связывание
комплекса trp-репрессор–триптофан с оператором
препятствует присоединению РНК-полимеразы к промотору.
вию РНК-полимеразы с промотором. При этих
условиях транскрипция оперона не осуществляется
и ферменты биосинтеза не образуются. В отсутствие
триптофана не происходит и связывания репрессора
с оператором, что позволяет РНК-полимеразе без
помех инициировать транскрипцию на промоторе
и синтезировать мРНК.
Аттенуация экспрессии триптофанового оперона.
Регуляция работы триптофанового оперона с помощью аттенуации осуществляется при участии последовательности, находящейся на расстоянии примерно 100–140 пар оснований от начала транскрипции (рис. 3.74). Этот так называемый лидерный
сегмент, trp L, содержит аттенуаторную последовательность, которая вынуждает РНК-полимеразу
прервать транскрипцию как раз перед началом
trp Е-гена с отделением фрагмента РНК длиной 141
нуклеотид – trp-лидерной мРНК. Подобная терминация происходит при уровнях триптофана в клетках от среднего до высокого. При низком уровне
триптофана терминация транскрипции в пределах
аттенуаторной последовательности в значительной
мере блокируется, и транскрипция проходит через
терминатор с образованием полноразмерной мРНК
trp-оперона.
Каков механизм регуляции терминации транскрипции в аттенуаторе с помощью изменения содер-
жания триптофана? Ответ на этот вопрос был получен после того, как определили нуклеотидную последовательность аттенуатора и установили, что на
аттенуацию влияет трансляция, идущая одновременно с транскрипцией. Участок из первых 145
нуклеотидов транскрипта trp-оперона содержит три
необычных по нуклеотидной последовательности
сегмента (рис. 3.76). Один из них кодирует короткий
полипептид из 14 аминокислот, две из которых
являются тандемными триптофановыми остатками.
Два других содержат инвертированные повторы,
из-за чего происходит внутримолекулярное спаривание оснований РНК-транскрипта и образование
двух альтернативных шпилечных структур (рис. 3.77).
Одна из этих структур, в которой спарены сегменты
1 и 2, 3 и 4 соответственно, опосредствует ρ-независимую терминацию транскрипции на участке из
нескольких расположенных подряд за четвертым
сегментом остатков урацила (разд. 3.2.г). Другая
шпилечная структура, в которой сегменты 2 и 3 спарены, а 1 и 4 остаются одноцепочечными, разрешает
транскрипции дойти до конца оперона.
Какая именно шпилечная структура образуется
при транскрипции аттенуаторного участка – зависит
от того, транслируется ли рибосомами полная последовательность, кодирующая полипептид длиной
14 аминокислот. Если синтез лидерного полипеп-
мРНК
trpоперона
Лидерный пептид
РРР
Конец лидерной
последовательности
Аттенуаторная последовательность
РИС. 3.76.
trpЕ
Лидерная trp-мРНК кодирует короткий пептид и содержит аттенуаторную последовательность. В лидерном
полипептиде имеются два расположенных рядом триптофановых остатка.
180
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 3.77.
Терминирующий сигнал
Аттенуированный
терминирующий сигнал
тида инициируется в кодоне AUG (рис. 3.76), то
рибосомы транслируют следующие 13 кодонов при
условии, что имеются все необходимые аминоацил-тРНК. При недостатке триптофанил-тРНК рибосомы останавливаются, когда доходят до тандемных триптофановых кодонов. Если рибосомы
останавливаются в одном из триптофановых кодонов, расположенных в аттенуаторном сегменте 1, то
последовательности сегментов 2 и 3 свободно спариваются и образуют шпилечную структуру, а сегмент 4 остается одноцепочечным (рис. 3.78). Эта
структура не препятствует продолжению транскрипции с образованием полноразмерной trp-мРНК длиной 7000 нуклеотидов. Если гриптофанил-тРНК
имеется в количестве, достаточном для трансляции
тандемных триптофановых кодонов, то рибосомы
движутся до терминаторного кодона лидерного пептида и, поскольку сегмент 2 ассоциирован с рибосомой, сегменты 3 и 4 образуют шпильку – структуру, способствующую терминации транскрипции.
Таким образом, аттенуатор позволяет РНК-полимеразе опосредованно «почувствовать» концентрацию триптофанил-тРНК через расположение рибосомы. Возможность трансляции короткой кодирующей последовательности в лидерном сегменте
определяет вторичную структуру транскрипта и,
следовательно, выбор между терминацией и прочтением последовательности. Наличие достаточного
количества триптофанил-тРНК стимулирует терминацию транскрипции, при ее недостатке транскрипция проходит весь оперон.
Суммарный эффект аттенуации и репрессии. Ат-
Альтернативные структуры со шпильками, которые образует лидерная
trp-мРНК. Нумерация нуклеотидных остатков такая же, как на рис. 3.76.
тенуация и репрессия вместе содействуют оптимальной экспрессии trp-оперона. При избытке триптофана благодаря репрессии блокируется инициация
синтеза мРНК. Снижение концентрации триптофана
приводит к уменьшению содержания функционального комплекса репрессор–триптофан, и транскрипция возобновляется. Однако при концентрации
триптофана, допускающей инициацию транскрипции, количества триптофанил-тРНК еще вполне достаточно для того, чтобы в пределах лидерного
участка в основном происходила терминация транскрипции; следовательно, в таких условиях уровень
экспрессии оперона еще очень низок. По мере снижения концентрации триптофана репрессия полностью
снимается: если концентрация триптофанил-тРНК
становится ниже уровня, необходимого для продолжения синтеза, то терминация аттенуируется,
а trp-мРНК и ферменты начинают синтезироваться
с большей скоростью. Таким образом, экспрессия
оперона достигает максимума в отсутствие репрессии и при максимальной аттенуации терминации;
экспрессия минимальна при почти полной репрессии
оперона и отсутствии аттенуации терминации.
Аттенуация как общий механизм. Аттенуация
используется при регуляции экспрессии многих генов и оперонов как у Е. coli, так и у других организмов. Оперон, кодирующий девять ферментов,
которые участвуют в биосинтезе гистидина, регулируется исключительно с помощью аттенуации;
аттенуатором служит полипептид-кодирующая последовательность с шестью тандемными гистидиновыми кодонами (рис. 3.79). У оперонов, функцио-
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
181
Положение рибосомы
при наличии достаточного
количества триптофана
Положение, в котором
останавливается рибосома
при недостатке триптофана
РИС. 3.78.
Образование разных шпилечных структур лидерной
trp-мРНК. Положение рибосомы определяет, какая
именно из двух альтернативных шпилек образуется,
и тем самым - сформируется ли структура, способствующая терминации транскрипции.
нирование которых зависит от содержания определенных аминокислот – треонина и изолейцина
(или лейцина), валина и изолейцина,– лидерный
участок буквально «напичкан» кодонами для этих
аминокислот. Антитерминация, т.е. ослабленная
терминация, не требует сопряжения трансляции
и транскрипции. Она может осуществляться некоторыми белками, допускающими экспрессию особых кластеров генов только после того, как синтезированы белки, способствующие аттенуации
(разд. 3.11.д).
вирусные гены экспрессируются в определенной временной последовательности, в результате чего образуется примерно сотня фаговых частиц и происходит лизис инфицированной бактерии. Развитие вируса, вызвавшего инфекцию, может пойти по лизогенному пути, при котором его ДНК встраивается
в ДНК клетки-хозяина в специфическом месте
(разд. 2.4.г). Интегрированная форма вирусного генома называется профагом. В лизогенных клетках
профаговая ДНК многократно реплицируется при
помощи клеточного аппарата так, как будто она
является частью клеточного генома. При этом, однако, все фаговые гены, кроме одного, выключены.
Лизогенные клетки переключаются на литический
путь либо спонтанно с низкой частотой, либо под
действием различных химических или физических
факторов. Независимо от природы индукции литического цикла «молчащие» ранее фаговые гены
включаются, запуская процессы, приводящие к образованию инфекционных фаговых частиц.
д. Временная регуляция
генной экспрессии
в жизненном цикле бактериофага λ
У бактериофага λ, есть два альтернативных способа существования. При литическом пути все
182
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
РИС. 3.79.
Некоторые опероны, лидерные мРНК которых содержат
многократно повторенные кодоны для аминокислот,
которые регулируют работу данного оперона.
Каким образом осуществляется временная регуляция экспрессии вирусных генов, обеспечивающая
строго определенный порядок репликации вирусной
ДНК, образования вирусных белков и сборку частиц
бактериофага при литической инфекции? Какие регуляторные механизмы определяют выбор литического или лизогенного пути развития для инфицирующих фагов? Эти вопросы заслуживают того,
чтобы обсудить их подробно. Пытаясь разобраться
в них, мы увидим, насколько элегантно осуществляется взаимодействие различных механизмов, которые используют прокариотические организмы
для регуляции своих фенотипов.
Литический путь. Определим сначала порядок
экспрессии генов при литической инфекции. На
рис. 3.80 показано расположение основных структурных и регуляторных генов на кольцевой и линейной картах фагового генома. Гены, кодирующие
структурные белки (головки и хвосты), сконцентрированы в одной области ДНК; гены, кодирующие
ферментативные (репликацию и рекомбинацию)
и регуляторные (репрессию и антитерминацию)
функции, сосредоточены в другой области генома.
После инфекции фаговая ДНК замыкается
в кольцо путем соединения липких концов
(разд. 2.4.г). Затем РНК-полимераза Е. coli транскрибирует те фаговые мРНК, которые кодируют
белки, необходимые на самых ранних этапах жизненного цикла,– так называемые предранние мРНК
(рис. 3.81). Одна из этих предранних мРНК транскрибируется справа налево с промотора PL, а терминатором
служит
последовательность
tL1.
На этой мРНК (L1) синтезируется регуляторный
белок N, работающий как антитерминатор. Другая
предранняя мРНК транскрибируется слева направо
с промотора PR к терминатору tR1 и кодирует
только белок Сro. Позднее мы обсудим роль этого
белка в выборе литического, а не лизогенного пути
развития фага.
По мере накопления белка N происходит аттенуация терминации в tLl и t R 1 , РНК-полимераза
Лизис
Поздняя регуляция
Головки
Репликация
Репрессия
Ранняя регуляция
Репрессия
Рекомбинация
Выщепление
и интеграция
Хромосома фага λ
48 502 т.п.н.
Хвосты
РИС. 3.80.
Линейная и кольцевая формы генома бактериофага λ с указанием
положения генов. Кольцевая форма образуется при отжиге линейной ДНК и лигировании одноцепочечных липких концов. Эти концы и места их соединения обозначены cos.
183
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Предранние мРНК
Задержанные
ранние мРНК
Поздние
РИС. 3.81.
Очередность экспрессии мРНК фага λ при литическом
пути развития.
продолжает транскрипцию через эти сайты с образованием мРНК второго типа – задержанных ранних
транскриптов. Более крупный транскрипт, начинающийся с промотора PL (L2 на рис. 3.81), кодирует ферменты, участвующие в рекомбинации,
и (что особенно важно) ферменты, катализирующие
встраивание ДНК фага λ в ДНК клетки-хозяина.
Задержанный ранний транскрипт, начинающийся
с промотора PR (транскрипт R2), кодирует ферменты, ответственные за репликацию фаговой ДНК
(белки O и Р), и еще один регуляторный белок Q.
Белок Q вызывает аттенуацию терминации транскрипции в терминаторном сайте (tR3), расположенном сразу за промотором P R ' . При транскрипции
с промотора PR' транскрибируются гены (S и R),
ответственные за включение лизиса клеток. Кроме
того, поскольку ДНК фага λ сразу после инфекции
замыкается в кольцо (рис. 3.80), S- и R-гены оказываются рядом с генами, кодирующими белки головки и хвоста фага. Следовательно, в результате
транскрипции, инициированной в PR и продолженной через tR3, образуется мРНК, кодирующая белки
лизиса и все структурные вирусные белки. Итак, мы
рассмотрели образование аппарата, необходимого
для литической инфекции: ферментов репликации
вирусной ДНК и вирусных белков, участвующих
в формировании зрелых фаговых частиц.
Лизогенный путь. Как происходит переключение
всей серии событий, настроенных на литический
цикл развития, на путь лизогении? Для того чтобы
понять это, нужно усложнить схему строения промоторов PL и РR и ввести несколько дополнительных генов, генных продуктов и промоторов.
На самом деле PL и РR являются частью сложной
регуляторной области, в которой промоторы перемежаются с операторными последовательностями
OL и ОR соответственно (рис. 3.82). OL и 0R –
это сайты связывания двух регуляторных белков:
репрессора сI и антирепрессора Сro. Как мы уже
говорили, белок Сrо – это продукт трансляции предранней мРНК, транскрибируемой вправо с промо-
тора PR. Репрессор кодируется геном сI, локализованным между PR и P L / O L (рис. 3.82). сI-мРНК
транскрибируется в направлении влево от промотора Р R Е , находящегося справа от Crо-гена. PRE сам
активируется двумя «позитивными» регуляторными
белками, cII и сIII, которые синтезируются после
того, как благодаря действию белка N образуются
транскрипты мРНК, инициированные в PR и PL,
соответственно.
По мере накопления репрессора сI происходит
его связывание с левым и правым операторными
сайтами, в результате чего подавляется экспрессия
всех генов, транскрибирующихся с PR и PL. В этом
случае предпочтительным оказывается лизогенный
путь, поскольку блокируется образование ферментов репликации и структурных вирусных белков,
а небольшое количество интеграционного фермента
Int, синтезированного с задержанной ранней мРНК,
успевает катализировать рекомбинацию между фаговой и бактериальной ДНК до момента полной
репрессии фаговых генов. После интеграции состояние лизогении поддерживается благодаря образованию в небольших количествах репрессора сI на
мРНК, транскрибируемой с промотора PRM, который находится непосредственно справа от структурного сI-гена.
Но может произойти переключение и на литический путь, что зависит от антирепрессорных и активаторных свойств Сrо. Сrо также связывается с OR
и OL, предотвращая тем самым связывание с ними
сI и сводя на нет репрессорное действие последнего.
По мере накопления Сrо синтез репрессора сI все
больше блокируется и накапливаются белки репликации, лизиса и структурные фаговые белки.
Связывание Сrо и сI с OR и OL. Чтобы понять
механизм очень тонкого антагонистического действия белков Сrо и cI, нам нужно выяснить природу
и расположение сайтов связывания, находящихся
в пределах операторов OR и OL. OR и OL каждый
состоит из тандемного кластера трех субоператоров: OL1, OL2, OL3 и O R 1 , OR2 и ОR3 соответственно.
OL перекрывается с PL, OR – c PR1 и OR3 – c PRM
(рис. 3.83). И Сrо, и сI связываются со всеми субоператорными сегментами, но относительное сродство
184
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
PL
PRM
PR
PRE
cro-мРНК
N-мРНК
РИС. 3.82.
cI-мРНК
Взаимное расположение промоторов и операторов, определяющих литический или лизогенный путь развития
бактериофага λ после инфекции. Показаны четыре различных промотора, а также несколько мРНК, кодирующих регуляторные белки Cro, peпpeccop cI и белок N.
их к этим сегментам различно. Так, Сrо наиболее
прочно связывается с OR3 и значительно слабее –
с OR2 и O R l . Связывание белка Сrо с OL уменьшается последовательно от OL3 к OL2 и далее к O L 1 .
Белок Сrо накапливается уже на ранних стадиях
cI-мРНК
инфекции, поэтому он связывается с О R 3 , предотвращая транскрипцию сI-гена с PRM. Поскольку OR1
и OLl остаются свободными до тех пор, пока концентрация белка Сrо не достигнет достаточно высокого уровня, транскрипция с PR и PL не подавляется.
OL3
Участок связывания
РНК-полимеразы
(P R )
OR1
OL2
OR2
OL1
Участок связывания
РНК-полимеразы
OR3
(PL)
Участок связывания
РНК-полимеразы
(PRM)
РИС. 3.83.
Участки связывания белка Сrо, репрессора cI и РНК-полимеразы в районе операторов OL и OR.
185
3. АППАРАТ ЭКСПРЕССИИ ГЕНОВ И ЕГО ЛОГИКА
Напротив, связывание белка Сrо с OR3 и ОL3 стимулирует транскрипцию с PR и PL соответственно.
Белок сI также обладает разным сродством к субоператорам. Наиболее прочно он связывается с субоператорами OR1 и O L l , поэтому транскрипция с PR
и PL блокируется при низких его концентрациях.
В этом случае связывание cI-peпpeccopa с OR1 также
стимулирует транскрипцию сI-гена с PRM.
Таким образом, выбор между литическим и лизогенным путями развития зависит от относительной скорости накопления четырех регуляторных
белков: репрессорного белка cI, антирепрессорного
белка Сrо и «позитивных» регуляторных белков cII
и cIII. Если доминирует антирепрессорная функция
Cro-белка, то предпочтение отдается литическому
пути. Если успевает установиться репрессия, то
функции, необходимые для реализации литического
пути, блокируются и происходит лизогенизация.
Поскольку равновесие между этими белками очень
неустойчивое, исход зависит от состояния бактерии-хозяина, от культуральной среды и от многих
других факторов.
е. Трансляционная регуляция
экспрессии некоторых генных
продуктов
Как мы уже говорили, экспрессия прокариотических генов, кодирующих РНК (например, рРНК,
тРНК), регулируется на двух этапах – на уровне
транскрипции и на уровне посттранскрипционных
модификаций и превращения предшественников
РНК в зрелые формы. Экспрессия некоторых генов,
кодирующих белки, также регулируется двумя путями. Первый из них состоит в регуляции содержания мРНК (разд. 3.11.в-д), второй основан на
репрессии трансляции. Рассмотрим два примера.
1. Геном каждого из близкородственных бактериофагов Е. coli – MS2, R17 и Qβ – представлен
единственной молекулой РНК, функционирующей
и в качестве генома, и в качестве мРНК, на которой
синтезируются белки, необходимые для размножения вирусов. Геном бактериофага MS2, одного из
представителей этого класса вирусов, состоит из
четырех генов (рис. 3.84). Один из них, rep, кодирует
субъединицу комплекса РНК-репликазы, которая
амплифицирует фаговую РНК для того, чтобы,
во-первых, обеспечить высокий уровень трансляции
фаговых генов и, во-вторых, снабдить геномами
фаговое потомство. Второй ген кодирует белок
оболочки (СР), 180 копий которого образуют вирусный икосаэдрический капсид. Третий ген кодирует белок А, или матуразу, который является
компонентом зрелой вирусной частицы и необходим
для адсорбции и проникновения вируса в клетку.
Четвертый ген детерминирует белок (Lys), обеспечивающий лизис инфицированных клеток и высвобождение вирусного потомства. Последовательность, кодирующая белок Lys, начинается на 3'-конце гена СР и продолжается до 5'-конца гена rep.
Однако рамка считывания для белка Lys сдвинута
на один нуклеотид относительно кодирующих последовательностей СР и Rep.
При нормальной инфекции СР присутствует
в клетке в больших количествах, Rep и Lys – в
значительно меньших, а А представлен только несколькими молекулами. Дифференциальная экспрессия
вирусных генов осуществляется благодаря тому, что
для рибосом доступен только инициаторный кодон
AUG гена СР. Соответствующие последовательности генов A, lys и rep находятся в двухцепочечных
участках молекулы РНК (рис. 3.41). Рибосомы редко транслируют ген А, а если быть точными, то
только один раз – в момент синтеза 5'-конца РНК.
Напротив, ген СР транслируется рибосомами многократно. При трансляции СР-кодирующей последовательности рибосомы разворачивают РНК и экспонируют инициаторный кодон AUG гена rep,
обеспечивая его трансляцию. Для того чтобы произошла трансляция Lys-кодирующей последовательности, рибосома иногда «неестественно» тран36
129
26
174
MS2
(f2, R17)
Матураза
(A)
1179
РИС. 3.84.
Белки лизиса
(lys)
Белок
75
оболочки
(СР)
390
Расположение четырех генов РНК-генома бактериофага
MS2 (3569 нуклеотидов). Длины 5'-лидерной последовательности, четырех генов и 3'-трейлерной последовательности, а также длины спейсеров между генами
Репликаза
(rep)
1635
А и СР и генами СР и rep выражены в числе нуклеотидов. Спейсер между генами СР и rep - это часть кодирующей области гена lys. (См. рис. 3.41.)
186
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
слоцируется (меняет место) при трансляции после- ной либо на 5'-конце мРНК, либо в начале одной
довательности гена СР, в результате чего вскоре из кодирующих последовательностей в середине
происходит терминация трансляции. Это приводит мРНК. В обоих случаях это блокирует доступ рик возобновлению трансляции в «неположенной» босом к ближайшей инициаторной трансляционной
инициаторной последовательности в пределах гена последовательности. В зависимости от места нахождения сайта инициации трансляции мРНК – вблизи
lys.
По мере увеличения концентрации СР проис- 5'-конца кодирующей последовательности или в одходит его связывание с последовательностью, ном из внутренних участков – блокируется трансляперекрывающей последовательность инициации ция всей мРНК или ее части. Контроль по типу
трансляции гена rep. Это предотвращает синтез обратной связи, при котором продукт регулирует
репликазы, но не препятствует образованию белков экспрессию собственного гена, называется аутогеноболочки. Итак, трансляция гена rep сначала регу- ной регуляцией. Регуляция может осуществляться на
лируется с помощью структурных ограничений, бла- уровне транскрипции (например, репрессорный бегодаря которым уменьшается доступность инициа- лок сI фага λ регулирует транскрипцию соответстторной последовательности для рибосом, и случай- вующего гена с Р R М ) и на уровне трансляции, как
ного сползания рибосом во время трансляции, в приведенном примере.
При сборке рибосом некоторые из рибосомных
а затем путем репрессии трансляции, обусловленной
связыванием белка оболочки с его инициаторной белков связываются с рРНК. Это наводит на мысль,
последовательностью.
что, возможно, свободная рРНК регулирует синтез
2. Синтез белков, составляющих собственно ап- рибосомных белков. Как это может происходить?
парат трансляции, регулируется на уровне трансля- При наличии достаточного количества рРНК вновь
ции. Гены, кодирующие белки больших (L) и малых синтезированные рибосомные белки ассоциируют
(S) субчастиц рибосомы и некоторых белков, участ- с ней, чтобы инициировать сборку рибосом. При
вующих в процессе трансляции (в том числе EF-Tu недостатке же рРНК накапливающиеся рибосомные
и EF-G), рассеяны по нескольким оперонам белки связываются с собственной мРНК вместо
(рис. 3.67). Это позволяет координированно регу- рРНК и соответственно блокируют собственный
лировать синтез тех генных продуктов, которые синтез и синтез других родственных рибосомных
должны функционировать согласованно. Экспрессия белков. В результате предотвращается накопление
таких генов как на уровне транскрипции, так и на свободных рибосомных белков. Таким образом,
уровне трансляции происходит координированно. некоторые ключевые рибосомные белки – это
Как мы увидим далее, синтез рибосомных белков репрессоры, блокирующие трансляцию кодируючастично регулируется также путем изменения со- щей их мРНК. Одновременно они блокируют синтез
держания трех рРНК и кинетических параметров и других белков, кодируемых той же мРНК. Спопроцесса сборки рибосом.
собность рибосомных белков узнавать как рРНК,
Контроль трансляции некоторых оперонов ри- так и свою собственную мРНК связана с тем, что
босомных белков осуществляется по одинаковому обе эти РНК обладают сходными нуклеотидными
механизму (табл. 3.7). Один из рибосомных белков, последовательностями (рис. 3.85). Так, последовакодируемый полицистронной мРНК, связывается со тельности, в которых рибосомные белки S8 и S7
специфической последовательностью, локализован- связываются с 16S-PHK и своими собственными
Таблица 3.7. Порядок расположения генов, кодирующих рибосомные белки, факторы
белкового синтеза и субъединицы РНК-полимеразы. Гены этих белков распределены
по мРНК, транскрибируемым с различных оперонов 1)
Оперон
Белки, кодируемые полицистронной мРНК
(начиная с 5'-конца мРНК)
str
spc
S10
S12
L14
S10
S13
L11
L10
α
L11
rif
S7 EF-G EF-Tu
L24 L5 S14 S8 L6 L18 S5 L30 L15 L30
L3 L2 L4 L23 S19 L22 S3 S17 L16 L29
S11 S4 α L17
L1
L7/12 β β'
Белокрегулятор
S7
S8
L4
S4
L1
L10
Инициаторная последовательность, с которой
связывается регулятор
S7
L5
S10
S13
L11
L10
1)
мРНК представлены в виде набора кодируемых ими белков. Первый белок соответствует 5'-концу мРНК.
Белки, гены которых регулируются координированно, подчеркнуты сплошной линией, а соответствующие белкирегуляторы указаны в 3-й колонке.
А
Сайт инициации трансляции
для белка S8
Участок связывания
белка S8 с 16S-рРНК
мРНК белка S8
Б
Сайт терминации
трансляции
для белка S7
Сайт инициации трансляции
для белка S7
Участок связывания белка S7 с
16S-pPHK
РИС. 3.85.
Иллюстрация положения, состоящего в том, что связывание одного из рибосомных белков с мРНК может
подавлять трансляцию этой мРНК. А. Сходство первичной и вторичной структур S8-мРНК (spc-оперон полицистронной мРНК) и участка связывания S8 с 16SрРНК. Б. Сходство первичной и вторичной структур
участка связывания белка S7 с 16S-pPHK и сайта инициации трансляции S7-мРНК (str-оперон полицистронной мРНК). Сходные нуклеотидные последовательности
выделены цветом. [М. Nomura et al., Proc. Natl. Acad. Sci.
USA, 77 (1980), p. 7084; J.D. Watson et al., Molecular
Biology of the Gene, 4th ed. (Menlo Park, Calif.: Benjamin/
Cummings, 1987). См. рис. 3.67 и табл. 3.7, где представлена более подробная информация об этих оперонах.]
188
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
мРНК, имеют сходную вторичную структуру, причем петли имеют идентичные последовательности.
Кроме регуляции на уровне трансляции при
образовании рибосомных белков осуществляется
также регуляция по типу обратной связи при транскрипции оперонов рибосомных белков. Мы не будем обсуждать регуляцию этих оперонов на уровне
транскрипции, а лишь отметим, что могут происхо-
дить репрессия и аттенуация транскрипции рибосомными субчастицами или даже целыми рибосомами. Наиболее вероятно, однако, что ключевым
пунктом в регуляции скорости синтеза рибосом
является образование рРНК. Таким образом, синтез
рибосомных белков и тем самым сборка рибосом
регулируются путем изменения содержания рРНК.
Литература
Введение
Приведены классические статьи и книги по генетике
и биохимии, в которых изложены основные концепции
молекулярной генетики. Список дан в хронологическом
порядке.
G. Mendel. 1866. Versushe über Pflanzen-Hybriden. Verhandlungen der Naturforschenden Verein, Brünn, 4, 3-47 (перепечатано в Journal of Heredity, 42, 3-47, 1951). Эта и еще
одна важная работа Менделя, „Über einige aus kunstlicher Befruchtung gewonnene Hieracium-Bastarde", напечатаны по-английски в кн.: С. Stern, E.R. Sherwood (eds.).
1966. The Origins of Genetics. A Mendel Source Book.
W.H. Freeman, San Francisco.
F. Miescher. 1871. Über die chemische Zusammensetzung der
Eiterzellen. Hoppe-Seyler's Medizinish-Chemischen Untersuchungen, 4, 441-460.
A.E. Garrod. 1902. Inborn Errors of Metabolism. Lancet, 2,
1616-1620.
W.S. Sutton. 1903. The Chromosomes in Heredity. Biol. Bull.,
4, 231-251.
A.E. Garrod. 1909. Inborn Errors of Metabolism. Frowde,
Hodder, and Stoughton, London.
W. Johannsen. 1909. Elemente der Exakten Erblichkeitslehre.
Fischer. Jena.
T.H. Morgan. 1910. Sex-Linked Inheritance in Drosophila.
Science, 32, 120-122.
T.H. Morgan, A.H. Sturtevant, H.J. Muller, С.В. Bridges.
1915. The Mechanism of Mendelian Heredity. Holt, Rinehart & Winston, New York.
B. McClintock, H.B. Creighton. 1931. A Correlation of Cytological and Genetical Crossing Over in Zea mays. Proc.
Natl. Acad. Sci. U.S.A., 17, 492-497.
B. McClintock. 1934. The Relation of a Particular Chromosomal Element to the Development of the Nucleoli in Zea
mays. A. Zellforsch. u Mikr. Anat., 21, 294-328.
G.W. Beadle, E.L. Tatum. 1941. Genetic Control of Biochemical Reactions in Neurospora. Proc. Natl. Acad. Sci. U.S.A.,
27, 499-506.
O.T. Avery, C.M. Macleod, M. McCarty. 1944. Studies on the
Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types. I. Induction of Transformation by a Desoxyribonucleic Acid Fraction Isolated from
Pneumococcus Type III. J. Exp. Med., 79, 137-158.
E. Chargaff, R. Lipschitz, C. Green, M.E. Hodes. 1951. The
Composition of the Deoxyribonucleic Acid of Salmon
Sperm. J. Biol. Chem., 192, 223-230.
D. M. Brown, A.R. Todd. 1952. Nucleotides. Part X. Some
Observations on the Structure and Chemical Behavior of
the Nucleic Acids. J. Chem. Soc., 52-58.
A.D. Hershey, M. Chase. 1952. Independent Functions of Viral
Protein and Nucleic Acid in Growth of Bacteriophage.
J. Gen. Physiol, 36, 39-56.
J.D. Watson, F.H.C. Crick. 1953. Molecular Structure of
Nucleic Acids: A Structure for Deoxynucleic Acids. Nature,
171, 737-738.
J.D. Watson, F.H.C. Crick. 1953. General Implications of the
Structure of Deoxyribonucleic Acid. Nature, 171, 964-967.
V.M. Ingram. 1957. Gene Mutations in Human Hemoglobin:
The Chemical Difference Between Normal and Sickle Cell
Hemoglobin. Nature, 180, 326-328.
M.B. Hoagland,
M.L. Stephenson,
J.F. Scott,
L.I. Hecht,
P.C. Zamecnik. 1958. A Soluble Ribonucleic Acid Intermediate in Protein Synthesis. J. Biol. Chem., 231, 241-257.
M. Mesehon, F.W. Stahl. 1958. The Replication of DNA in
Escherichia coli. Proc. Natl. Acad. Sci. U.S.A., 44, 671-682.
A. Kornberg. 1960. Biological Synthesis of Deoxyribonucleic
Acid. Science, 131, 1503-1508.
S. Brenner, F. Jacob, M. Meselson. 1961. An Unstable Intermediate Carrying Information from Genes to Ribosomes
for Protein Synthesis. Nature, 190, 576-581.
F. Jacob, J. Monod. 1961. Genetic Regulatory Mechanisms in
the Synthesis of Proteins. J. Mol. Biol., 3, 318-356.
M.W. Nirenberg, H.J. Matthaei. 1961. The Dependence of
Cell-Free Protein Synthesis in E. coli upon Naturally Occurring or Synthetic Polyribonucleotides. Proc. Natl. Acad.
Sci. U.S.A., 47, 1588-1602.
C. Yanofsky, B.C. Carlton, J.R. Guest, D.R. Helinski, U. Henning. 1964. On the Colinearity of Gene Structure and
Protein Structure. Proc. Natl. Acad. Sci. U.S.A., 51,
266-272.
The Genetic Code. 1966. Cold Spring Harbor Symp. Quant.
Biol., 31, whole issue.
В следующих работах описано историческое развитие генетики и биохимии нуклеиновых кислот.
J.S. Fruton. 1972. Molecules and Life. Wiley-Interscience, New
York.
H. Stubbe. 1972. History of Genetics: From Prehistoric Times
to the Discovery of Mendel's Laws. Translated by
T.R.W. Waters. MIT Press, Cambridge, Massachusetts.
R. Olby. 1974. The Path to the Double Helix. University of
Washington Press, Seattle.
F.H. Portugal, J.S. Cohen. 1977. A Century of DNA. MIT
Press, Cambridge, Massachusetts.
H.F. Judson. 1979. The Eighth Day of Creation. Simon and
Schuster, New York.
Общие работы для всех глав части I
С.К. Cantor, P.R. Schimmel. 1980. Biophysical Chemistry.
W.H. Freeman, San Francisco. [Имеется перевод: Кантор Ч., Шиммел П. Биофизическая химия: В 3-х т. - М.:
Мир, 1983-1985 гг.]
B. Alberts, D. Bray, J. Lewis, M. Raff, K. Roberta, J.D. Watson.
1983. Molecular Biology of the Cell. Garland. New York.
[Имеется перевод: Албертс Б., Уотсон Дж., Моне Дж.
и др. Молекулярная биология клетки: В 5 т. - М.: Мир,
1986-1987 гг.]
C. Zubay. 1983. Biochemistry. Addison-Wesley, Reading, Massachusetts.
J. Darnell, H. Lodish, D. Baltimore. 1986. Molecular Cell Biology. Scientific American Books, New York.
D. Freifelder. 1987. Molecular Biology, 2nd ed. Jones and
Bartlett, Boston.
B. Lewin. 1987. Genes, 3rd ed. Wiley, New York. [Имеется
190
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
перевод 2-го издания с дополнениями: Льюин Б. Гены. М.: Мир, 1987.]
J.D. Watson,
N.H. Hopkins,
J.W. Roberts,
J.A. Steitz,
A.M. Weiner. 1987. Molecular Biology of the Gene, 4th ed.
Benjamin/Cummings, Menlo Park, California.
J.D. Rawn. 1988. Biochemistry. Carolina Biological Supply
Co., New York.
L. Stryer. 1988. Biochemistry, 3rd ed. W.H. Freeman, San
Francisco. [Имеется перевод 2-го издания: Страйер Л.
Биохимия. - М.: Мир, 1985.]
Литература к указанным разделам глав
1.1.
F.H.C. Crick, J.D. Watson. 1954. The Complementary Structure of Deoxyribonucleic Acid. Proc. Roy. Soc., 223 (4),
80-96.
F.H.C. Crick. 1976. Linking Numbers and Nuclcosomes. Proc.
Natl. Acad. Sci. U.S.A., 73, 2639-2643.
W.R. Bauer, F.H.C. Crick, J.H. White. 1980. Supercoiled
DNA. Sci. American, 243, 118-133.
A. Kornberg. 1980 and 1982 supplement. DNA Replication.
W.H. Freeman, San Francisco. [Имеется перевод издания 1974 г.: Корнберг А. Синтез ДНК. - М.: Мир, 1977.]
R.D. Kornberg, A. Klug. 1981. The Nucleosome. Sci. American,
244, 52-79.
R.E. Dickerson,
H.R. Drew,
B.N. Conner,
R.M. Wing,
A.V. Fratini, M.L. Kopka. 1982. The Anatomy of A-, Band Z-DNA. Science, 216, 475-485.
A. Klug. 1982. From Macromolecules to Biological Assemblies.
Nobel lecture. Nobel Foundation, Stockholm, Sweden.
Structure of DNA. 1982. Cold Spring Harbor Symp. Quant.
Biol., 47 whole issue.
J.C. Wang. 1982. DNA Topoisomerases. Sci. American, 247,
94-109.
A. Rich, A. Nordheim, H.-J. Wang. 1984. The Chemistry and
Biology of Left-Handed Z-DNA. Annu. Rev. Biochem., 53,
791-846.
W. Sanger. 1984. Principles of Nucleic Acid Structure. Springer-Verlag, New York. [Имеется перевод: Зенгер В.
Принципы структурной организации нуклеиновых кислот. - М.: Мир, 1987.]
G. Felsenfeld. 1985. DNA. Sci. American, 253 (4), 58-67.
D.E. Pettijohn. 1988. Histone-like Proteins and Bacterial Chromosome Structure. J. Biol. Chem., 263, 12793-12796.
K.E. van Holde. 1988. Chromatin. Springer-Verlag, New York.
R.D. Wells. 1988. Unusual DNA Structures. J. Biol. Chem.,
263, 1095-1098 (краткий обзор).
1.2
R.W. Holley. 1968. The Nucleotide Sequence of a Nucleic Acid.
Sci. American, 214, 30-39.
A. Rich, U.L. Raj Bhandary. 1976. Transfer RNA: Molecular
Structure, Sequence and Properties. Annu. Rev. Biochem.,
45, 805-860.
H.F. Noller. 1984. Structure of Ribosomal RNA. Annu. Rev.
Biochem., 55, 119-162.
J.E. Darnell, Jr. 1985. RNA. Sci. American, 253 (4), 68-78.
1.3
R.E. Dickerson, I. Geis. 1969. The Structure and Action of
Proteins. Benjamin/Cummings, Menlo Park, California.
Т.Е. Creighton. 1983. Proteins: Structure and Molecular Properties. W.H. Freeman, San Francisco.
R.E. Dickerson, 1. Geis.
1983.
Hemoglobin:
Structure,
Function, Evolution and Pathology. Benjamin/Cummings,
Menlo Park, California.
C. Chothia. 1984. Principles That Determine the Structure of
Proteins. Annu. Rev. Biochem., 53, 537-572.
R.F. Doolittle. 1985. Proteins. Sci. American, 253 (4), 88-99.
R.J. Fletterick, T. Schroer, R.J. Matela. 1985. Molecular Structure: Macromolecules in Three Dimensions. Blackwell
Scientific Publications, Oxford, England.
M.E. Goldberg. 1985. The Second Translation of the Genetic
Message: Protein Folding and Assembly. Trends Biochem.
Sci., 10, 388-391.
2.1
J. Cairns. 1966. The Bacterial Chromosome. Sci. American,
214, 36-44.
W. Gilbert, D. Dressier. 1968. DNA Replication: The Rolling
Circle Model. Cold Spring Harbor Symp. Quant. Biol., 33,
473-484.
J.S. Sussenbach, P.C. Van der Vliet, D.J. Ellens, H.S. Jansz.
1972. Linear Intermediates in the Replication of Adenovirus
DNA. Nature New Biol., 239, 47-49.
J.D. Watson. 1972. Origin of Concatameric T7 DNA. Nature
New Biol., 235, 197-201.
J.D. Wolfson, D. Dressier, M. Magazin. 1972. Bacteriophage T7
DNA Replication: A Linear Replicating Intermediate. Proc.
Natl. Acad. Sci. U.S.A., 69, 499-504.
I.R. Lehman. 1974. DNA Ligase: Structure, Mechanism and
Function. Science, 186, 790-797.
D. Bastia, M. Sueoka, E. Cox. 1975. Studies in the Late Replication of Phage λ: Rolling Circle Replication. J. Mol. Biol.,
98, 305-320.
D.M. Rekosh, W.C. Russel, A.J.D. Bellet, A.J. Robinson. 1977.
Identification of a Protein Linked to the Ends of Adenovirus DNA. Cell, 11, 283-295.
DNA: Replication and Recombination. 1978. Cold Spring
Harbor Symp. Quant. Biol. 43 whole issue.
S.H. Wickner. 1978. DNA Replication Proteins of Escherichia
coli. Annu. Rev. Biochem., 47, 1163-1191.
T.J. Kelly, Jr., R.L. Lechner. 1976. The Structure of Replicating Adenovirus DNA Molecules: Characterization of
DNA-Protein Complexes from Infected Cells. Cold Spring
Harbor Symp. Quant. Biol., 43, 721-728.
N.R. Cozzarelli. 1980. DNA Gyrase and the Supercoiling of
DNA. Science, 207, 953-960.
M. Gellert. 1981. DNA Topoisomerases. Annu. Rev. Biochem.,
50, 879-910.
Y. Hirota, M. Yamada, A. Nishimura, A. Oka, K. Sugimoto,
K. Asada, M. Takanami. 1981. The DNA Replication Origin (ori) of Escherichia coli: Structure and Function of the
ori-Containing DNA Fragment. Prog. Nucleic. Acid. Res.,
26, 33-48.
O. Sundin, A. Varshavsky. 1981. Arrest of Segregation Leads to
Accumulation of Highly Intertwined Catenated Dimers:
Dissection of the Final Stages of SV40 DNA Replication.
Cell, 25, 659-669.
B.M. Alberts, B.P. Bedinger, T. Formosa, C.V. Jongeneel,
K.N. Kreuzer. 1982. Studies on DNA Replication in the
Bacteriophage T4 in vitro Systems. Cold Spring Harbor
Symp. Quant. Biol., 47, 655 668.
B.M. Baroudy, S. Venkatesan, B. Moss. 1982. Structure and
Replication of Vaccinia Virus Telomeres. Cold Spring
Harbor Symp. Quant. Biol., 47, 723-729.
B.W. Stillman, F. Tamenoi. 1982. Adenoviral DNA Replication:
DNA Sequences Required for Initiation in vitro. Cold
Spring Harbor Symp. Quant. Biol., 47, 741-750.
A. Kornberg. 1983. Mechanism of Replication of the E. coli
Chromosome. Eur. J. Biochem., 137, 377-382.
N.G. Nossal. 1983. Prokaryotic DNA Replication Systems.
Annu. Rev. Biochem., 52, 581-615.
B.M. Alberts. 1984. The DNA Enzymology of Protein Machines. Cold Spring Harbor Symp. Quant. Biol., 49, 1-12.
S. Dinardo, K. Voelkel, R. Sternglanz. 1984. DNA Topoisomerase II Is Required for Segregation of Daughter Molecules at the Termination of DNA Replication. Proc. Natl.
ЛИТЕРАТУРА
Acad. Sci. U.S.A., 81, 2616-2620.
M. Kaguni, A. Kornberg. 1984. Replication Initiated at the
Origin (oriC) of the E. coli Chromosome Reconstituted with
Purified Enzymes. Cell, 38, 183-190.
J. Tomizawa. 1984. Control of Col E1 Plasmid Replication: The
Process of Binding of RNA I to the Primer Transcript. Cell,
38, 861-870.
T. Kirchhausen. J.C. Wang, S.C. Harrison. 1985. DNA Gyrase
and Its Complexes with DNA: Direct Observation by
Electron Microscopy. Cell, 41, 933-943.
C.S. McHenry. 1985. DNA Polymerase I I I Holoenzyme of
Escherichia coli: Components and Function of a True
Replicative Complex. Mol. Cell. Biochem., 66, 71-85.
B.W. Stillman, Y. Gluzman. 1985. Replication and Supercoiling
of SV40 DNA in Cell-Free Extracts from Human Cells.
Mol. Cell. Biol., 5, 2051-2060.
J.L. Campbell. 1986. Eukaryotic DNA Replication. Annu. Rev.
Biochem., 55, 733-771.
H. Echols. 1986. Multiple DNA-Protein Interactions Governing Hign-Precision DNA Transactions. Science, 233,
1050-1056.
A. Maxwell, M. Gellert. 1986. Mechanistic Aspects of DNA
Topoisomerases. Adv. Prot. Chem., 38, 69-107.
S.A. Wasserman, N.R. Cozzarelli. 1986. Biochemical Topology:
Applications to DNA Recombination and Replication.
Science, 232, 951-960.
C.M. Joyce, T. Steitz. 1987. DNA Polymerase I: From Crystal
Structure to Function via Genetics. Trends Biochem. Sci.,
12, 288-292.
T. Kelly, B. Stillman (eds.). 1988. Eukaryotic DNA Replication.
Cold Spring Harbor Laboratory, New York.
A. Kornberg. 1988. DNA Replication. J. Biol. Chem., 263, 1-4.
2.2
D. Baltimore. 1970. Viral RNA-Dependent DNA Polymerase.
Nature, 226, 1209-1211.
H.M. Temin, S. Mizutani. 1970. Viral RNA-Dependent DNA
Polymerase. Nature, 226, 1211-1213.
E. Giboa, S.W. Mitra, S. Goff, D. Baltimore. 1979. A Detailed
Model of Reverse Transcription and Tests of Crucial
Aspects. Cell, 18, 93-100.
W.S. Mason, J.M. Taylor, R. Hull. 1987. Retroid Virus Genome Replication. Adv. Virus Res., 32, 35-96.
H. Varmus. 1987. Reverse Transcription. Sci. American, 257,
56-64.
2.3
P. Howard-Flanders. 1981. Inducible Repair of DNA. Sci.
American, 245, 72-103.
T. Lindahl. 1982. DNA Repair Enzymes. Annu. Rev. Biochem.,
51, 61-87.
L.A. Loeb, T.A. Kunkel. 1982. Fidelity of DNA Synthesis.
Annu. Rev. Biochem., 51, 429-457.
A. Sancar, W.D. Rupp. 1983. A Novel Repair Enzyme:
UVRАВС Excision Nuclease of Escherichia coli Cuts
a DNA Strand on Both Sides of the Damaged Region. Cell,
33, 249-260.
A.T. Yeung, W.B. Mattes, E.Y. Oh, L. Grossman. 1983. Enzymatic Properties of Purified Escherichia coli uvrABC Proteins. Proc. Natl. Acad. Sci. U.S.A., 80, 6157-6161.
E.C. Friedberg. 1984. DNA Repair. W.H. Freeman, San Francisco.
A. Sancar, G.B. Sancar. 1988. DNA Repair Enzymes. Annu.
Rev. Biochem., 57, 29-67.
2.4
N. Sigal, B. Alberts. 1972. Genetic Recombination: The Nature
of a Crossed Stranded Exchange Between Two Homologous DNA Molecules. J. Mol. Biol., 71, 789-793.
191
S.A. Latt. 1979. Sister Chromatid Exchanges. Genetics, 92,
583-595.
F.W. Stahl. 1979. Genetic Recombination: Thinking About It in
Phage and Fungi. W.H. Freeman, San Francisco.
C. DasGupta, A. Wu, R. Kahn, R. Cunningham, C. Radding.
1981. Concerted Strand Exchange and Formation of Holliday Structures by E. coli RecA Protein. Cell, 25, 507-516.
H. Nash. 1981. Integration and Excision of Bacteriophage λ:
The Mechanism of Conservative Site Specific Recombination. Annu. Rev. Genet, 15, 143-167.
C. Radding. 1982. Homologous Pairing and Strand Exchange
in Genetic Recombination. A n n u . Rev. Genet., 16, 405-437.
J. Szostak, T. Orr-Weaver, R. Rothstein, F. Stahl. 1983. The
Double-Strand Break Repair Model for Recombination.
Cell, 33, 25-35.
R. Weisberg, A. Landy. 1983. Site-Specific Recombination in
Phage λ In R. Hendrix, J. Roberts, F. Stahl and R. Weisberg (eds.), Lambda II, pp. 211-250. Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.
M.M. Cox, I.R. Lehman. 1987. Enzymes of General Recombination. Annu. Rev. Biochem., 56, 229-262.
P. Modrich. 1987. DNA Mismatch Correction. Annu. Rev.
Biochem., 56, 435-466.
2.5
S. Spiegelman, I. Haruna, I.B. Holland, B. Beaudreau, D. Mills.
1965. The Synthesis of a Self-Propagative and Infectious
Nucleic Acid with a Purified Enzyme. Proc. Natl. Acad. Sci.
U.S.A., 54, 919-927.
T. Blumenthal, G.C. Carmichael. 1979. R N A Replication: Function and Structure of QB-Replicase. Annu. Rev. Biochem.,
48, 525-548.
3.1
F.H.C. Crick. 1958. On Protein Synthesis, Biological Replication of Macromolecules. Symp. Exp. Biol., 12, 138-163.
J.D. Watson. 1963. The Involvement of RNA in the Synthesis
of Proteins. Science, 140, 17-26.
H. Weissbach, S. Pestka (eds.). 1977. Molecular Mechanisms of
Protein Biosynthesis. Academic Press, New York.
3.2
J.W. Roberts. 1969. Termination Factor for RNA Synthesis.
Nature, 224, 1168-1174.
A.A. Travers, R.R. Burgess. 1969. Cyclic Reuse of the RNA
Polymerase Sigma Factor. Nature, 222, 537-540.
C. Lowery-Goldhammer, J.P. Richardson. 1974. An RNA-Dependent Nucleoside Triphosphate Phosphohydrolase
(ATPase) Associated with Rho Termination Factor. Proc.
Natl. Acad. Sci. U.S.A., 71, 2003-2007.
M. Rosenberg, D. Court. 1979. Regulatory Sequences Involved
in the Promotion and Termination of RNA Transcription.
Annu. Rev. Genet., 13, 319-353.
R. Losick, J. Pero. 1981. Cascades of Sigma Factors. Cell, 25,
582-584.
M. Chamberlin. 1982. Bacterial DNA-Dependent RNA Polymerases. In P.D. Boyer (ed.), The Enzymes, part B, vol. 15,
pp. 61-108. Academic Press, New York.
R. Rodriguez, M. Chamberlin (eds.). 1982. Promoters: Structure
and Function. Praeger, New York.
O.K. Hawley, W.R. McClure. 1983. Compilation and Analysis
of Escherichia coli Promoter DNA Sequences. Nucleic Acid
Res., 11, 2237-2255.
P.H. von Hippel, D.G. Bear, W.D. Morgan, J.A. McSwiggen.
1984. Protein-Nucleic Acid Interactions in Transcription:
A Molecular Analysis. Annu. Rev. Biochem., 53, 389-446.
W.R. McClure. 1985. Mechanism and Control of Transcription
Initiation in Prokaryotes. Annu. Rev. Biochem., 54,
171-204.
T. Platt. 1986. Transcription Termination and the Regulation
of Gene Expression. Annu. Rev. Biochem., 55, 339-372.
192
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
С.A. Brennan, A.J. Dombrowski, T. Platt. 1987. Transcription
Termination Factor Rho Is an RNA-DNA Helicase. Cell,
48, 945-952.
3.3
E. Lund, J.E. Dahlberg, L. Lindahl, R. Jaskunas, P.P. Dennis,
M. Nomura. 1976. Transfer R N A Genes Between 16S
rRNA Gene in RNA Transcription Units. Cell, 7, 165-177.
J.D. Smith. 1976. Transcription and Processing of Transfer
RNA Precursors. Proc. Nucleic Acid. Res.,16, 25-73.
N. Nakajima, H. Ozeki, Y. Shimura. 1977. Organization and
Structure of an E. coli tRNA Operon Containing Seven
tRNA Genes. Cell, 23, 239-249.
P. Gegenheimer, D. Apirion. 1981. Processing of Prokaryotic
Ribonucleic Acid. Microbiol. Rev., 45, 502-541.
S. Altman, C. Guerrier-Takeda, H. Frankfort, H. Robertson.
1982. RNA Processing Nucleases. In S. Linn and R. Roberts (eds.), Nucleases, pp. 243-274. Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.
H.D. Robertson. 1982. Escherichia coli Ribonuclease III Cleavage Sites. Cell, 30, 669-672.
M. Deutscher. 1984. Processing of tRNA in Prokaryotes and
Eukaryotes. Crit. Rev. Biochem., 17, 45-71.
3.4
F.H.C. Crick. 1958. On Protein Synthesis, Biological Replication of Macromolecules. Symp. Exp. Biol., 12, 158-163.
F.H.C. Crick, L. Barnett, S. Brenner. R.J. Watts-Tobin. 1961.
General Nature of the Genetic Code for Proteins. Nature,
192, 1227-1232.
M.W. Nirenberg, J.H. Matthaei. 1961. The Dependence
of Cell-Free Protein Synthesis in E. coli upon Naturally
Occurring or Synthetic Polyribonucleotides. Proc. Natl.
Acad. Sci. U.S.A., 47, 1588-1682.
J.F. Speyer. P. Lengyel, C. Basilica, A.J. Wahba, R.S. Gardner, S. Ochoa. 1963. Synthetic Polynucleotides and the
Amino Acid Code. Cold Spring Harbor Symp. Quant. Biol.,
28, 559-568.
M. Nirenherg, P. Leder. 1964. The Effect of Trinucleotides
upon the Binding of sRNA to Ribosomes. Science, 145,
1399-1407.
A.S. Sarabhai, A.O. Stretton, S. Brenner, A. Bolle. 1964. Colinearity of the Gene with the Polypeptide Chain. Nature,
201, 13-17.
C. Yanofsky, B.C. Carlton, J.R. Guest, D.R. Helinski, U. Henning. 1964. On the Colinearity of Gene Structure and
Protein Structure. Proc. Natl. Acad. Sci. U.S.A., 51, 266272.
F.H.C. Crick. 1966. Codon-Anticodon Pairing: The Wobble
Hypothesis. J. Mol. Biol., 19, 548-555.
The Genetic Code. 1966. Cold Spring Harbor Symp. Quant.
Biol., 31, whole issue.
M. Yeas. 1969. The Biological Code. Wiley-Interscience, New
York.
3.5
P. Berg, E.J. Ofengand. 1958. An Enzymatic Mechanism for
Linking Amino Acids to RNA. Proc. Natl. Acad. Sci.
U.S.A., 44, 78-86.
M.B. Hoagland, M.L. Stephenson, J.F. Scott, L.I. Hecht,
P.C. Zamecnik. 1958. A Soluble Ribonucleic Acid Intermediate in Protein Synthesis. J. Biol. Chem., 231, 241-257.
F. Chapeville, F. Lipmann, G.V. Elivenstein, B. Weisblum.
W.J. Ray, Jr. S. Benzer. 1962. On the Role of Soluble
Ribonucleic Acid in Coding for Amino Acids. Proc. Natl.
Acad. Sci. U.S.A., 48, 1086-1092.
R.W. Holley. 1966. The Nucleotide Sequence of a Nucleic Acid.
Sci. American, 214, 30-39.
M. Nomura. 1973. Assembly of Bacterial Ribosomes. Science,
179, 864-873.
A. Rich, U.L. Raj Bhandary. 1976. Transfer RNA: Molecular
Structure, Sequence and Properties. Annu. Rev. Biochem,
45, 805-860.
A. Rich, S.H. Kim. 1978. The Three-Dimensional Structure of
Transfer RNA. Sci. American, 238, 56-62.
P.R. Schimmel, D. Soil. 1979. Amino Acyl tRNA Synthetases:
General Features and Recognition of tRNAs. Annu. Rev.
Biochem., 48, 601-648.
I. Wool. 1979. The Structure and Function of Eucaryotic
Ribosomes. Annu. Rev. Biochem., 48, 719-754.
J.A. Lake. 1981. The Ribosome. Sci. American, 245, 84-97.
К.Н. Nierhaus. 1982. Structure, Assembly and Function of
Ribosomes. Current Topics in Microbiol. and Immun., 97,
82-155.
P. Schimmel, S. Putney, R. Starzyk. 1982. RNA and DNA
Sequence Recognition and Structure-Function of Amino
Acyl t R N A Synthetases. Trends Biochem. Sci., 7, 209-212.
H.G. Wittmann. 1982. Components of Bacterial Ribosomes.
Annu. Rev. Biochem., 51, 155-183.
H.G. Wittmann. 1983. Architecture of Prokaryotic Ribosomes.
Annu. Rev. Biochem., 52, 35-66.
M. Yarus, R. Thompson. 1983. Precision of Protein Biosynthesis. In: J. Beckwith, J. Davies, J.A. Gallant (eds.), Gene
Function in Prokaryotes, pp. 23-63. Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.
H.F. Noller. 1984. Structure of Ribosomal RNA. Annu. Rev.
Biochem., 53, 119-162.
D.M. Blow, P. Brick. 1985. Amino Acyl tRNA Synthetases. In:
F.A. Jurnak, A. McPherson (eds.), The Structure of Biological Macromolecules and Assemblies, vol. 2, Nucleic Acid
Binding Proteins, pp. 442-469. Wiley, New York.
J.A. Lake. 1985. Evolving Ribosome Structure: Domains in
Archaebacteria, Eubacteria, Eocytes and Eukaryotes. Annu.
Rev. Biochem, 54, 507-530.
G.R. Björk, J.U. Ericson, C.E.D. Gustafsson, T.G. Hagerrall,
Y.H. Jönsson, P.M Wilkström. 1987. Transfer RNA Modification. Annu. Rev. Biochem., 56, 263-288.
P. Schimmel. 1987. Amino Acyl tRNA Synthetases: General
Scheme of Structure-Function Relationship in the Polypeptides and Recognition of Transfer RNAs. Annu. Rev.
Biochem., 56, 125-158.
3.6
H.M. Dintzis. 1961. Assembly of the Peptide Chain of Hemoglobin. Proc. Natl. Acad. Sci. U.S.A., 47, 247-261.
J. Shine, L. Dalgarno. 1974. The 3'-Terminal Sequence of E. coli
16S rRNA: Complementarity to Nonsense Triplets and
Ribosome Binding Sites. Proc. Natl. Acad. Sci. U.S.A., 71,
1342-1346.
Y. Kaziro. 1978. The Role of Guanosine 5'-Triphosphate in
Polypeptide Chain Elongation. Biochem. Biophys. Acta,
505, 95-127.
M. Grunberg-Manago. 1980. Initiation of Protein Synthesis as
Seen in 1979. In: G. Chambliss, G.R. Craven, J. Davies,
K. Davis, L. Kahan, and M. Nomura (eds.), Ribosomes:
Structure, Function and Genetics, pp. 445-478. University
Park Press. Baltimore.
J. Ofengand. 1980. The Topography of tRNA Binding Sites on
the Ribosome. In: G. Chambliss, G. R. Craven, J. Davies,
K. Davis, L. Kahan, and M. Nomura (eds.), Ribosomes:
Structure, Function and Genetics, pp. 497-530. University
Park Press, Baltimore.
H. Weissbach. 1980. Soluble Factors in Protein Synthesis. In:
G. Chamliss, G.R. Craven, J. Davies, K. Davis, L. Kahan,
M. Nomura (eds.), Ribosomes: Structure, Function and
Genetics, pp. 445-478. University Park Press, Baltimore.
L. Gold, D. Pribnow, T. Schneider, S. Shinedling, B.S. Singer,
G. Starmo. 1981. Translational Initiation in Prokaryotes.
Annu. Rev. Microbiol., 35, 365-403.
R.A. Garrett, P. Wooley. 1982. Identifying the Peptidyl Trans-
ЛИТЕРАТУРА
ferase Centre. Trends Biochem. Sci., 7, 385-386.
A. Johnson, H. Adkins, E. Matthews, C. Cantor. 1982. Distance
Moved by Transfer RNA During Translocation from the
A Site to the P Site on the Ribosome. J. Mol. Biol., 156,
113-140.
M. Kozak. 1983. Comparision of Initiation of Protein Synthesis
in Prokaryotes, Eukaryotes and Organelles. Microbiol.
Rev., 47, 1-45.
C.T. Caskey, W.S. Forrester, W. Тate. 1984. Peptide Chain
Termination. In: B. Clark and H. Petersen (eds)., Alfred
Benzon Symposium, vol. 19, pp. 457-466. Munksgaard,
Copenhagen.
K. Moldave. 1985. Eukaryotic Protein Synthesis. Annu. Rev.
Biochem., 54, 1109-1149.
3.7
K. Moldave. 1965. Nucleic Acids and Protein Biosynthesis.
Annu. Rev. Biochem., 34, 419-448.
F.H.C. Crick. 1966. Codon-Anticodon Pairing: The Wobble
Hypothesis. J. Mol. Biol., 19, 548-555.
Protein Synthesis. 1969. Cold Spring Harbor Symp. Quant.
Biol., 34, whole issue.
B.A. Hamkalo, O.L. Miller, Jr. 1973. Electron Microscopy of
Genetic Activity. Annu. Rev. Biochem., 42, 379-396.
R. Haselkorn, L.B. Rothman-Denes. 1973. Protein Synthesis.
Annu. Rev. Biochem., 42, 397-438.
M. Nomura, A. Tissieres, P. Lengyel (eds.). 1974. Ribosomes.
Cold Spring Harbor Laboratory, Cold Spring Harbor, New
York.
E. Beronak. 1978. Mechanisms in Polypeptide Chain Elongation on Ribosomes. Proc. Nucl. Acid Res. Mol. Biol., 21,
63-100.
M. Grunberg-Manago,
R.H. Buckingham,
B.S. Cooperman,
J.W.B. Hershey. 1978. Structure and Function of the
Translation Machinery. Symp. Soc. Gen. Microbiol., 28,
27-110.
D.A. Steege, D.G. Söll. 1979. Suppression. In: R.F. Goldberger
(ed.), Biological Regulation and Development I, pp. 433486. Plenum, New York.
H. Ozeki, H. Inokuchi, F. Yamao, M. Kodaira, H. Sakano,
T. Ikemura, Y. Shimura. 1980. Genetics of Nonsense Suppressor tRNAs in E. coli. In: D. Söll, J.M. Abelson,
P.R. Schimmel (eds.), Transfer RNA, Biological Aspects, pp.
341-349. Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York.
J.R. Roth. 1981. Frameshift Suppression. Cell, 24, 601-602.
M. Yarns, R. Thompson. 1983. Precision of Protein Biosynthesis. In: J. Beckwith, J. Davies, J.A. Gallant (eds.), Gene
Function in Prokaryotes, pp. 23-63. Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.
3.8
K. Moldave. 1985. Eukaryotic Protein Synthesis. Annu. Rev.
Biochem., 54, 1109-1149.
3.9
J.H. Goldberg, P.A. Friedman. 1971. Antibiotics and Nucleic
Acids. Annu. Rev. Biochem., 40, 775-810.
H.M. Sobell. 1974. How Actinomycin Binds to RNA. Sci.
American, 231, 82-91.
S. Pestka. 1977. Inhibitors of Protein Biosynthesis. In:
H. Weissbach, S. Pestka (eds.), Molecular Mechanisms of
Protein Biosynthesis, pp. 467-553. Academic Press, New
York.
R.J. Subadolnik. 1979. Naturally Occurring Nucleoside and
Nucleotide Antibiotics. Prog. Nucl. Acid Res. Mol. Biol., 22,
193-291.
E. Cundliffe. 1980. Antibiotics and Prokaryote Ribosomes:
Action, Interaction and Resistance. In: G. Chambliss,
G.R. Craven, J. Davies, K. Davis, L. Kahan, M. Nomura
(eds)., Ribosomes: Structure, Function and
pp. 377-412. University Park Press, Baltimore.
193
Genetics,
3.10
S. Michaelis, J. Beckwith. 1982. Mechanism of Incorporation of
Cell Envelope Proteins in Escherichia coli. Annu. Rev.
Microbiol., 36, 435-465.
G. Schatz, R.A. Butow. 1983. How Are Proteins Imported into
Mitochondria? Cell, 32, 316-318 (краткий обзор).
T.J. Silhavy, S.A. Benson, S.D. Emr. 1983. Mechanisms of
Protein Localization. Microbiol. Rev., 47, 313-344.
L.L. Randall, S.J.S. Hardy. 1984. Export of Protein in Bacteria: Dogma and Data. In: B. Satir (ed.), Modern Cell
Biology, vol. 3, pp. 1-20. Liss, New York.
P. Walter, R. Gilmore, G. Blobel. 1984. Protein Translocation
Across the Endoplasmic Reticulum. Cell, 38, 5-8.
J.E. Rothman. 1985. The Compartmental Organization of the
Golgi Apparatus. Sci. American, 253 (3), 74-89.
R. Scheckman. 1985. Protein Localization and Membrane Traffic. Annu. Rev. Cell Biol., 1, 115-143.
M. Schleyer, W. Neupert. 1985. Transport of Proteins into
Mitochondria: Translocational Intermediates Spanning
Contact Sites Between Outer and Inner Membranes. Cell,
43, 339-350.
S.R. Pfeffer, J.E. Rothman. 1987. Biosynthetic Protein Transport by the Endoplasmic Reticulum and Golgi. Annu. Rev.
Biochem., 56, 829-852.
J.E. Rothman. 1987. Protein Sorting by Selective Retention in
the Endoplasmic Reticulum and Golgi Stack. Cell, 50,
521-522.
H.F. Lodish. 1988. Transport of Secretory and Membrane
Glycoproteins from the Rough Endoplasmic Reticulum to
the Golgi. J. Biol. Chem., 263, 2107-2110.
D. Raise, G. Schatz. 1988. Mitochondrial Presequences. J. Biol.
Chem., 263, 4509-4511 (краткий обзор).
3.11
F. Jacob, J. Monod. 1961. Genetic Regulatory Mechanisms in
the Synthesis of Proteins. J. Mol. Biol., 3, 318-356.
S. Adhya, M. Gottesman. 1978. Control of Transcription Termination. Annu. Rev. Biochem., 47, 967-996.
W. Fiers. 1979. Structure and Function of RNA Bacteriophages. Соmр. Virology, 13, 69-204.
R.F. Goldberger (ed.). 1979. Biological Regulation and Development. I. Gene Expression. Plenum, New York.
J. Miller, W. Reznikoff (eds.). 1980. The Operon. Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York.
C. Yanofsky, R. Kolter. 1982. Attenuation in Amino Acid Biosynthesis Operons. Annu. Rev. Genet, 16, 113-134.
C. Bauer, J. Carey, L. Kasper, S. Lynn, D. Woechter, J. Gardner. 1983. Attenuation in Bacterial Operons. In: J. Beckwith, J. Davies, J. Gallant (eds.), Gene Function in
Prokaryotes, pp. 65-89. Cold Spring Harbor Laboratory,
Cold Spring Harbor, New York.
K.M. Campbell. C.D. Starmo, L. Gold. 1983. Protein-Mediated
Translation Repression. In: J. Beckwith, J. Davies, J. Gallant (eds.), Gene Function in Prokaryotes, pp. 185-187.
Cold Spring Harbor Laboratory, Cold Spring Harbor,
New York.
R.W. Hendrix, J.W. Roberts, F.W. Stahl, R.A. Weisberg (eds.).
1983. Lambda II. Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York.
O.C. Uhlenbeck, J. Carey,
P.J. Romaniok,
P.T. Lowary,
D. Beckett. 1983. Interaction of R17 Coat Protein with Its
RNA Binding Site for Translational Repression. J. Biomol.
Structure and Dynamics, 1, 539-552.
B. De Crombrugghe, S. Busby, H. Вис. 1984. Cyclic AMP
Receptor Protein: Role in Transcription Activation. Science,
224, 831-838.
S. Gottesman. 1984. Bacterial Regulation: Global Regulatory
194
ЧАСТЬ I. МОЛЕКУЛЯРНЫЕ ОСНОВЫ НАСЛЕДСТВЕННОСТИ: ОБЗОР
Networks. Annu. Rev. Genet., 18, 415-442.
M. Nomura, R. Course, G. Baughman. 1984. Regulation of the
Synthesis of Ribosomes and Ribosomal Components. Annu.
Rev. Biochem., 53, 75-117.
C. Pabo, R. Sauer. 1984. Protein-DNA Recognition. Annu. Rev.
Biochem., 58, 293-321.
D. Raibaud, M. Schwartz. 1984. Positive Control of Transcription Initiation in Bacteria. Annu. Rev. Genet., 18, 173-206.
M . B . Matthews (ed.). 1986. Translational Control. Current
Communications in Molecular Biology. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
M. Ptashne. 1986. A Genetic Switch, Gene Control and Phage
λ. Cell Press and Blackwell Scientific Publications, Palo
Alto, California. [Имеется перевод: Пташне М. Переключение генов. Регуляция генной активности и фаг λ. М.: Мир, 1988.]
С. Yanofsky. 1988. Transcription Attenuation. J. Biol. Chem.,
263, 609-612.
Часть II
ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
ВВЕДЕНИЕ
Примерно к 1970 г. стали известны основные
свойства генетических систем. Несмотря на отсутствие многих важных деталей, удалось установить
принципы репликации, рекомбинации и репарации
и каждый из этих процессов был воспроизведен in
vitro. Была сформулирована центральная догма,
согласно которой генетическая информация передается от ДНК к РНК и далее к белку, что создало
основу для определения генотипа и фенотипа организма на молекулярном уровне. Был идентифицирован основной посредник при переносе информации от ДНК к белку – информационная РНК (мРНК).
Расшифрован генетический код, и в экспериментах
с реконструированными клеточными компонентами
в системе in vitro была получена информация о клеточном аппарате и основных механизмах трансляции мРНК в белок. Подтвердилось предположение
о том, что процессы транскрипции ДНК в РНК
и трансляции РНК в белок регулируются и что
существуют позитивный и негативный способы
контроля функций генов. С расшифровкой генетического кода разрешился имеющий долгую историю
вопрос о связи между химической структурой гена
и кодируемого им белка и стало ясно, что мутации
есть следствие изменений в структуре ДНК. В этот
период выдающихся открытий неожиданной наградой исследователям стала идентификация многих
ферментов, для которых нуклеиновые кислоты
являются субстратом. Получение их в очищенном
виде и определение свойств в значительной мере
облегчило анализ структуры и функций нуклеиновых кислот, а применение в дальнейших исследованиях привело к созданию новой области молекулярной биологии – технологии рекомбинантных
ДНК.
Несмотря на широко распространенное мнение,
что всем генетическим системам присущи одни и те
же основные свойства, процессы, происходящие
в клетках прокариот, изучены значительно глубже,
чем процессы, протекающие в эукариотических
организмах. Действительно, провести генетический
анализ небольших по размеру и менее сложно организованных бактериальных геномов значительно
проще, чем геномов эукариот. Сравнительно легко
удалось индуцировать и идентифицировать мутационные изменения в специфических генах. Случайный обмен генетической информацией между
различными бактериями и некоторыми бактериями
и их вирусами (бактериофагами) облегчил картирование этих генов, что в свою очередь позволило
установить организацию бактериальных и фаговых
геномов в целом. Еще более важное значение имело
замечательное взаимопроникновение генетики и
биохимии. Совместное использование генетических
и биохимических методов способствовало разгадке
сложного процесса репликации ДНК и даже позволило осуществить полноценную репликацию in vitro
вирусных геномов. Благодаря объединению этих
методов удалось получить отдельные гены в изолированном виде, что подготовило почву для изучения транскрипции и трансляции генов in vitro
и идентификации молекулярных продуктов, участвующих в этих процессах. С помощью того же
двустороннего подхода был установлен механизм регуляции экспрессии генов: было показано, что контроль осуществляется главным образом путем взаимодействия между специфичными
белками и соответствующими регуляторными последовательностями в ДНК или информационной
РНК.
В то же время успехи в расшифровке молекулярной структуры, организации и функций эукариотического генома были весьма скромными.
Сложные генетические карты локусов, содержащих
мутации, удалось составить лишь для тех немногих
эукариотических организмов, с чьими генетическими системами можно было проводить манипуляции
(к их числу относились некоторые виды дрожжей,
Neurospora crassa, D. melanogaster). По сравнению
с ними генетические карты млекопитающих, в частности мыши и человека, представлялись сплошными «белыми пятнами». Еще более загадочными
196
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
были молекулярная структура эукариотических генов и их организация в хромосомных ДНК, в
частности наличие множественных повторов некоторых сегментов ДНК у большинства эукариот. Без
более полного изучения молекулярной структуры
геномов эукариот дальнейший прогресс в этой области был невозможен.
Биохимические исследования экспрессии и регуляции эукариотических генов также зашли в тупик
из-за отсутствия информации о структуре клеточных генов. Было ясно, что ядерная ДНК эукариот
транскрибируется в РНК и что мРНК транслируется
в белки с помощью цитоплазматических комплексов
рибосома–тРНК, во многом напоминающих прокариотические (гл. 3). Однако механизм транскрипции и последующая судьба транскриптов оставались совершенно загадочными. У многих эукариот
только небольшая фракция ядерной РНК (<10%)
переходит в цитоплазму в виде информационной,
рибосомной и транспортной РНК. Некоторые молекулы существуют в стабильной форме в виде
коротких цепей РНК в составе рибонуклеопротеиновых частиц, однако большинство из них быстро
деградирует, не покидая ядра. Вопросы о природе
быстро распадающейся РНК, ее происхождении и
функции постоянно дебатировались. Проблема биогенеза информационной РНК также оставалась нерешенной из-за различий между мРНК про- и эукариот. У последних в начале и в конце молекул
имеются особые структуры – так называемые кэпы
и роlу(А)-хвосты соответственно. Это указывало на
то, что информационная РНК эукариот в процессе
биогенеза подвергается посттранскрипционным модификациям. Почему, где и как происходят такие
модификации? Каково их значение? Каков путь
превращения первичных транскриптов ДНК в зрелые молекулы информационной РНК? Далее, как
осуществляется контроль транскрипции и превращений РНК, образованных на разных генах, в разных типах клеток одного и того же организма? Чем
различаются механизмы экспрессии и регуляции
генов у про- и эукариот? Из-за отсутствия молекулярно-генетической информации и методологии
для ее получения эти вопросы первостепенной важности оставались нерешенными.
На фоне появления все новых данных об организации и экспрессии генетической информации у прокариот отсутствие таких данных для эукариот становилось все более ощутимым. Для преодоления
такого отставания нужна была общая методология
исследования клеточных геномов эукариот на молекулярном уровне. В идеале это позволило бы
выделить дискретные гены и определить их молекулярную структуру и организацию геномов. При
наличии таких изолированных генетических элементов можно было бы затем установить биохимичес-
кие основы механизмов транскрипции и трансляции.
Объективные предпосылки к этому появились лишь
в первой половине 70-х годов, когда была разработана технология получения рекомбинантных молекул ДНК. Прежде чем обсуждать эти достижения,
мы рассмотрим концепции и методологию, которые
подготовили почву для решающих экспериментов.
Они ведут начало от экспериментов в сфере бактериальной генетики, и особенно большую роль здесь
сыграла возможность введения молекул ДНК в
клетки бактерий. Такая введенная ДНК независимо
от того, произошла ли она из бактериофага или из
других бактериальных клеток, изменяет генотип,
а нередко и фенотип реципиентной клетки. Гены
донорной ДНК способны экспрессироваться и могут рекомбинировать с хромосомной ДНК.
ВВЕДЕНИЕ НОВОЙ
ГЕНЕТИЧЕСКОЙ ИНФОРМАЦИИ
В КЛЕТКИ БАКТЕРИЙ
Бактерии могут приобретать новый генетический
материал несколькими способами. Это: 1) трансформация, при которой в клетки проникают молекулы ДНК, добавленные в культуральную среду;
2) конъюгация, в процессе которой ДНК непосредственно переносится от одной клетки к другой;
3) опосредуемая бактериофагами трансдукция, при
которой новая генетическая информация вводится
в клетку с частицей бактериофага. Независимо от
способа попадания в реципиентную клетку донорная ДНК рекомбинирует с гомологичными участками или специфическими сайтами в геноме реципиентного организма или сохраняется в виде автономной мини-хромосомы, изменяя таким образом
генотип хозяина.
Трансформация бактерий
Трансформация, т.е. изменение генотипа клетки путем внесения в нее молекул ДНК из культуральной среды, была первым из способов введения новых генов в клетки бактерий. Это послужило также первым доказательством роли
ДНК как носителя генетической информации.
Если в клетки организма с определенным генетическим нарушением (например, организма, не
способного синтезировать триптофан, сбраживать галактозу, образовывать какой-то полисахарид и т.п.) ввести ДНК, выделенную из нормальных клеток, то у этого организма нередко
восстанавливаются утраченные функции. Такая
трансформация является обычно наследственной и стабильной, поскольку в ее основе лежит
197
ВВЕДЕНИЕ
рекомбинация между функциональным геном (генами) донорной ДНК и дефектным геном (генами)
реципиента. Однако осуществляемая с помощью
ДНК трансформация оказалась полезной только
при изучении молекулярной генетики прокариот.
В других случаях возможности трансформации
ограничивались трудностями выявления трансформирующего гена, что делало нереальным определение его структуры. Тем не менее принцип трансформации нашел применение в другой области.
Например, получение трансформированных клеток
является важным этапом во многих экспериментах
с рекомбинантными молекулами ДНК. Термин
«трансформация» используется в молекулярной
биологии эукариот для обозначения стабильного
изменения генотипа и фенотипа клетки.
Конъюгация
При конъюгации осуществляется прямой перенос
ДНК из одной клетки в другую при их контактировании. В тех случаях, когда конъюгация происходит
между определенными штаммами E. coli, один из
них выполняет функции донора, другой – реципиента (рис. II.1). Хромосомная ДНК донорной
клетки переходит в клетку реципиента по мостику,
образующемуся между двумя клетками. Полный
перенос ДНК осуществляется примерно за 90 мин,
однако в случае повреждения мостика конъюгация
прерывается и перенос хромосомы оказывается неполным.
Разные штаммы Е. coli начинают перенос с разных точек хромосомы. Следовательно, у различных
доноров ранними или поздними генами во время
конъюгации оказываются разные группы генов.
Однако перенос генов всегда происходит только
в одном из двух возможных противоположных направлений кольцевой хромосомы E. coli (рис. II.2).
Эти эксперименты впервые показали, что все гены
Е. coli расположены на одной кольцевой молекуле
ДНК (рис. II.3). Сравнивая время, необходимое для
переноса различных генов во время конъюгации,
можно построить генетическую карту хромосомы
Е. coli, т.е. установить порядок следования хромосомных генов.
Гены
Донорная
клетка
Сайт
инициации
переноса
Соединение клеток и
репликация ДНК
в донорной клетке
Реципиентная
клетка
Перенос одной цепи ДНК
от донора
Разрыв конъюгационного мостика
Поздний
Ранний
РИС. II.1.
Перенос генетической информации между
бактериями при конъюгации. Две клетки
Е. coli, из которых одна передает свою хромосому другой, вступают в контакт с помощью белкового конъюгационного мостика. Репликация донорной ДНК начинается в особом участке (отмечен точкой), и одна из цепей ДНК переносится в клетку
реципиента. Перенос прекращается при
разрыве конъюгационного мостика (при
случайном движении клеток или встряхивании сосуда, в котором эти клетки находятся). Чем продолжительнее контакт двух
клеток до разрыва мостика, тем большее
число генов переносится. Перенесенная
ДНК может с помощью рекомбинации заменить соответствующую часть генома реципиентной клетки. У разных штаммов
Е. coli перенос инициируется в различных
хромосомных локусах.
198
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
Донорный штамм
Порядок переноса генов
1
2
3
4
5
6
РИС. II.2.
Перенос ДНК при конъюгации начинается с разных
генов в зависимости от штамма донора. Например,
штамм 1 начинает перенос с гена thr, а штамм 2 с гена
met. Группы генов всегда переносятся в одном из двух
взаимно противоположных направлений (например, в
штаммах 1, 2 и 3 порядок переноса - thr-leu-azi, в штамме 4 перенос начинается между azi и leu; в штаммах
5 и 6 - azi-leu-thr, и т.д.)
Трансдукция
нию генотипа последней. Каждая трансдуцирующая
фаговая частица обычно содержит только один
случайный фрагмент исходной донорной хромосомы. Вероятность включения в такую частицу любой
части этого генома примерно одинакова. Однако
благодаря довольно большому размеру трансдуцируемых сегментов ДНК (для определенных бактериофагов он составляет около 100 т.п.н., или 2,5%
всей хромосомы Е. coli) обычно реципиентная клетка
приобретает за один акт трансдукции целую группу
генов. В результате гены, тесно сцепленные друг
с другом в хромосоме донора, с высокой частотой
котрансдуцируются, тогда как гены, удаленные друг
от друга, трансдуцируются независимо (рис. II.5).
Определение частоты котрансдукции генов помогает уточнить генетические карты, позволяя оценить
относительные расстояния между тесно сцепленными генами.
Трансдукция второго типа, специфическая, свойственна бактериофагам, инфекционный цикл которых прерывается в результате включения генома
вируса в специфический хромосомный локус ДНК
инфицированной клетки (гл. 2). Бактерии, содержащие такие интегрированные фаговые геномы, получили название лизогенных. Они несут вирусные геномы как наследственные элементы в своих собственных хромосомах (рис. II.6). В лизогенной клетке
вирусные и клеточные геномы реплицируются как
единое целое и являются взаимно совместимыми.
Интеграция фагового генома с геномом клеткихозяина лишает фаг возможности вызывать гибель
клетки и продуцировать инфекционное потомство.
По этой причине бактериофаг, способный лизогенизировать, в отличие от вирулентного фага получил
название умеренного. При определенных условиях –
индукции – лизогенное состояние прерывается и вирусный геном вырезается из хромосомы клетки-хозяина. Он реплицируется, образует множество вирусных частиц и убивает клетку. Обычно вырезание
вирусного генома происходит очень точно, и образующийся фаг содержит вирусный геном, полно-
Охарактеризованы два типа трансдукции, осуществляемой с помощью бактериофагов, общая и
специфическая. При общей трансдукции фаговые
частицы, содержащие сегменты ДНК клетки-хозяина, переносят относительно протяженные участки
геномной ДНК от одной бактериальной клетки
к другой. Трансдуцирующие фаговые частицы образуются в ходе определенных инфекционных процессов, когда ДНК клетки эффективно деградирует
и фрагменты, по размеру примерно соответствующие фаговому геному, случайно упаковываются в
зрелые частицы бактериофага (рис. II.4). В результате последующего инфицирования клеток бактерий
популяцией фаговых частиц, содержащей трансдуцирующие фаги, происходит передача ДНК донорных клеток этим инфицируемым клеткам. Рекомбинация между введенными фрагментами донорной
ДНК и ДНК клетки-реципиента приводит к измене-
РИС. II.3.
Кольцевая генетическая карта Е. coli, на которой указано
положение отдельных генов. Порядок генов в хромосоме соответствует указанному на рис. II.2. Точками отмечены области инициации переноса в донорных штаммах, представленных на рис. II.2.
Образование
трансдуцирующих
частиц
Лизис
Фаг,
несущий
ген х+
+
Бактерия,
содержащая ген х+
Трансдуцирующий фаг
Жизнеспособный фаг
Трансдукция
х–-бактерии
х + -фагом
Фрагмент х–
(будет деградирован)
Инфицирование
х + -Трансдуктант
Бактерия,
несущая ген х–
РИС. II.4.
Образование фаговых частиц,
осуществляющих общую трансдукцию, и введение донорной ДНК
в инфицируемую клетку. Один из
трансдуцирующих фагов несет
бактериальный ген х+ дикого типа, который при последующем
инфицировании вводится в бактериальную клетку, несущую мутантный ген х–. В результате рекомбинации эта клетка превращается в х+-трансдуктант.
Геном
бактерииреципиента
Смесь фрагментов
трансдуцирующей
фаговой ДНК
Инфицирование
+
РИС. II.5.
Зависимость частоты котрансдукции генов от расстояния между
ними. Гены i и j могут трансдуцироваться как независимо, так и
совместно, поскольку они тесно
сцеплены друг с другом в бактериальной хромосоме. Ген h находится достаточно далеко от обоих
генов и не может быть котрансдуцирован с ними.
Бактериальные
трансдуктанты
200
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
Инфицирование
Замыкание
фаговой ДНК в кольцо
Интеграция
Лизоген
Репликация хромосомы,
деление клетки
Индукция,
вырезание
Репликация,
образование
фаговых частиц
Лизис
РИС. II.6.
Основные события, ведущие к установлению лизогенного состояния, индукции лизогенов и образованию фагового потомства. Перед встраиванием в бактериальную
хромосому инфицирующая ДНК замыкается в кольцо
и после вырезания тоже превращается в кольцевую
форму.
стью соответствующий исходному. Иногда, однако,
фаговый геном вырезается неправильно и в дочерние фаговые геномы включаются хромосомные гены, прилегавшие к интегрированному вирусному
геному. Эти гены включаются вместо некоторых
вирусных генов (рис. II.7). Во время следующего
цикла инфекции гены клетки-донора переходят
вместе с фаговыми генами в реципиентные клетки.
После включения ДНК трансдуцирующего фага
в геном реципиента клетка приобретает наряду с фаговыми генами генетическую информацию предыдущего хозяина фага. Таким образом, при специфической трансдукции фаг служит вектором для
переноса генов из одной клетки в другую. С помощью этого механизма трансдуцируются только
те хромосомные гены клетки-хозяина, которые тесно сцеплены с сайтом интеграции вирусного генома.
Поскольку различные умеренные фаги встраиваются в разные хромосомные сайты, при их неправильном вырезании образуются фаги, которые
трансдуцируют разные хромосомные гены. Так, фаги λ трансдуцируют гены, ответственные за метаболизм галактозы (λ gal), или гены, контролирующие
синтез биотина (λ bio), а фаги φ80 – различное число
генов, кодирующих ферменты биосинтеза триптофана (рис. II.8). Были разработаны определенные
генетические приемы, способствующие приобретению этими и другими фагами различных генов
E. coli или генов родственых организмов. Та же
стратегия с небольшими модификациями позволяет
получить трансдуцирующие фаги, содержащие мутантные бактериальные гены. Такие трансдуцирующие фаги легко идентифицировать, размножить
и очистить, что позволяет получать значительные
количества аллелей дикого или мутантного генов
Е. coli в высокоочищенном виде.
Обогащение бактериальными генами, сопровождающее их включение в геном трансдуцирующих
фагов, имеет важные последствия. Рассмотрим,
например, ген Е. coli, кодирующий фермент β-галактозидазу (lac Z). Этот белок состоит из идентичных полипептидных цепей длиной 1173 аминокислотных остатка; следовательно, ген, кодирующий этот полипептид, содержит около 3600 пар
нуклеотидов. Ген β-галактозидазы составляет одну
тысячную генома E. coli (3,6•103 из 4,0•106 п.н.), но
в геноме трансдуцирующего вируса λ lac он занимает 1/15 часть (3,6•103 из 5•104 п.н.). Таким образом, ДНК фага λ lac обогащена β-галактозидазным
геном примерно в 100 раз больше, чем ДНК E. coli.
Это упрощает выделение β-галактозидазного гена
и позволяет идентифицировать его регуляторные
участки и определить их нуклеотидную последовательность. Подобным же образом с получением
трансдуцирующих фагов φ80 trp удалось выделить
и охарактеризовать гены и регуляторные последо-
201
ВВЕДЕНИЕ
РИС. II.7.
Фаг λ
Приобретение клеточных генов трансдуцирующим фагом λ.
Место встраивания
Интеграция
Лизоген
Вырезание
Вырезание
Сайт интеграции
фага λ
Сайт интеграции фага φ80
РИС. II.8.
Различные фаги, осуществляющие специфическую
трансдукцию, переносят только те бактериальные гены,
которые расположены вблизи сайта их интеграции в
хромосому. Показаны сайты интеграции фагов λ (λ att)
и φ80 (φ80 att).
Вырезание
вательности, которые образуют триптофановый
оперон (разд. 3.11.г). Кроме того, благодаря трансдукции появилась возможность изучать влияние
различных мутационных изменений на экспрессию
и регуляцию генов in vivo.
Рассмотрим те свойства фагового генома, которые ответственны за его способность к специфической трансдукции (рис. II.9). Во-первых, геном
должен быть способен реплицироваться после того,
как произошла инфекция [т.е. в вирусной ДНК
должны сохраняться область начала репликации
(ori) и гены, необходимые для осуществления репликации]. Во-вторых, он должен приобрести ковалентно сцепленный сегмент невирусной ДНК, который будет трансдуцироваться. Этот сегмент ДНК
обычно имеет клеточное происхождение, но в принципе он может быть из любого источника. Он
может включиться в любое место вирусного генома,
если это не влияет на репликацию вирусной ДНК
в инфицированой клетке хозяина или на ее способность упаковываться в зрелые фаговые частицы.
Будучи составной частью фагового генома, трансдуцируемый сегмент ДНК реплицируется вместе
202
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
Недефектный трансдуцирующий геном
Гены,
кодирующие
вирусные
белки
Гены,
необходимые для
осуществления
репликации
Экзогенная
вставка
Точка
инициации
репликации
(ori)
А
РИС. II.9.
А. Недефектный вирусный геном, содержащий
все гены, необходимые для репликации и упаковки вирусной ДНК. Б. Дефектный геном,
в котором отсутствуют гены, кодирующие вирусные белки. Такие белки должны кодироваться генами клетки-хозяина или коинфицирующего вируса.
Дефектный трансдуцирующий геном
Экзогенная вставка
Гены,
необходимые для
осуществления
репликации
Точка
инициации
репликации
Б
с вирусной ДНК. В-третьих, гены, кодирующие
структурные фаговые белки, должны быть функционально активными либо их роль должен выполнять коинфицирующий фаг или клетка-хозяин.
И наконец, если мы хотим использовать трансдукцию, нам нужно найти способ разделения различных типов вирусных геномов и идентификации интересующего нас генома, поскольку трансдуцирующие вирусы часто инфицируют клетку совместно
с вирусом дикого типа. Обычно для такого разделения используют клонирование.
ПРИНЦИПЫ КЛОНИРОВАНИЯ
Чтобы понять, как использовались концепции
трансдукции при разработке методов получения рекомбинантных ДНК, нам следует ознакомиться
с тем, что представляет собой клонирование. Клон
вируса или клеток – это некая популяция, каждый
член которой ведет происхождение от одного репродуцирующегося вириона или от одной клетки соответственно. Все члены клона независимо от того,
являются ли они вирусами или клетками, по существу идентичны вирусу или клетке, которые дали
РИС. II.10.
Вирусный клон - это популяция вирусных
частиц, образовавшихся в результате репликации ДНК одной частицы. Схематически
показано образование трех вирусных клонов. На бактериальном газоне каждый клон
образует отдельные бляшки.
Вирусный клон 1
Вирусный клон 2
Вирусный клон 3
203
ВВЕДЕНИЕ
начало клону; они также идентичны друг другу. При
клонировании вирусов необходимо, чтобы вирусное
потомство из одной клетки, инфицированной одной
вирусной частицей, размножалось в течение многих
циклов инфекции, не смешиваясь с потомством из
других инфицированных клеток (рис. II.10). Такие
вирусные клоны образуют прозрачные зоны (или
бляшки) на монослое (или газоне) неинфицированных клеток. Клонирование клеток можно осуществить только в том случае, если клетки при размножении остаются изолированными друг от друга
(рис. II.11). Клоны бактериальных клеток или клеток млекопитающих легко образуются при разреженном посеве их на чашке таким образом, что они
образуют отдельные колонии.
С помощью клонирования получают чистый
препарат одного генома, поскольку все члены клона
содержат идентичные ДНК. Эта концепция молекулярного клонирования используется и при получении чистых препаратов определенных молекул рекомбинантных ДНК.
КОНЦЕПЦИЯ
РЕКОМБИНАНТНОЙ ДНК
Молекулы ДНК, способные реплицироваться в соответствующих клетках, представленные вирусными
геномами или плазмидами (см. ниже), служат переносчиками, или векторами, «чужеродных» сегментов
ДНК, получивших название вставки. При этом,
вместо того чтобы полагаться на клеточные процессы, ведущие к образованию рекомбинантных
трансдуцирующих геномов, проводят объединение,
или рекомбинацию, соответствующим образом модифицированных вставок и векторов in vitro с помощью фермента ДНК-лигазы (рис. II.12). Такие
рекомбинантные ДНК вводят затем в соответствующие клетки, где они амплифицируются в результате репликации.
Громадные потенциальные возможности этой
методологии обусловлены не только тем, что с ее
помощью можно конструировать и реплицировать
рекомбинантную ДНК, но и тем, что она позволяет
клонировать отдельные рекомбинантные молекулы
ДНК. Рассмотрим, например, что получается в результате объединения смеси случайных сегментов
ДНК какого-либо организма с векторной ДНК
(рис. II.13). Ассортимент всех возможных рекомбинантов чрезвычайно разнообразен; каждый рекомбинант содержит какой-то определенный сегмент
Методология получения рекомбинантных ДНК
основана на тех же принципах, что и трансдукция.
РИС. II.11.
Клеточный клон - это популяция клеток, полученная в результате множественных клеточных делений от одной клетки. Каждый клон представлен
отдельной колонией.
Клеточный клон 1
Клеточный клон 2
Бактериальные клетки
Клеточный клон 3
Клетки млекопитающих
Отдельные клетки
Агар
Рост клеток и
многократное
деление
Рост клеток и
многократное
деление
Колонии (клоны)
204
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
Чужеродная ДНК
Лигирование
Лигирование
РИС. II.12.
Встраивание чужеродных фрагментов ДНК (а и b) в
кольцевую и линейную молекулы вирусной ДНК in vitro.
исходной ДНК. Однако при клонировании рекомбинантных ДНК с образованием отдельных вирусных бляшек в каждой вирусной частице из данной
бляшки содержится уникальная рекомбинантная
ДНК, состоящая из векторной ДНК и одного из
сегментов исходного генома. Таким образом, технология рекомбинантных ДНК позволяет выделять
отдельные сегменты ДНК из чрезвычайно сложной
смеси сегментов, происходящих из клеточного или
вирусного генома.
В результате переноса какого-то гена Е. coli из
бактериального генома в геном трансдуцирующего
фага можно получить примерно 100-кратное обогащение по этому гену. По сравнению с тем уровнем
обогащения, которого удается достичь путем молекулярного клонирования сегментов ДНК сложных
организмов, такое обогащение является незначительным. Например, ген млекопитающих длиной
5 т.п.н. составляет лишь одну миллионную часть
всего генома (5 т.п.н. от ~ 3•106 т.п.н.) и примерно
одну десятую часть рекомбинантного генома фага
λ. Таким образом, молекулярное клонирование позволяет расщеплять даже самые большие и самые
сложно организованные геномы и получать отдельные сегменты, содержащие один или несколько генов в чистом виде. Такое относительно простое
применение принципов и методов, разработанных
при изучении молекулярной генетики прокариот,
устранило барьер, который препятствовал проведению подобного анализа на эукариотических геномах.
ВАЖНЫЕ
ОТКРЫТИЯ
Как это часто бывает при развитии науки, методологии рекомбинантных ДНК прокладывали путь
многие открытия, казавшиеся ранее незначительными и не имеющими отношения к делу. Одним из
таких открытий была трансдукция. Другие связаны
с выделением и изучением свойств бактериальных
плазмид и рестриктирующих эндонуклеаз.
Бактериальные плазмиды
Одним из неожиданных следствий использования антибиотиков для леченя инфекционных заболеваний было появление устойчивых штаммов патогенных микроорганизмов. Эта очень важная проблема требовала своего решения и стимулировала
интенсивные исследования. Вскоре стало ясно, что
устойчивость к лекарственным препаратам представляет собой относительно стабильный генетический признак, который может быть передан чувствительным бактериальным клеткам способом, напоминающим инфекционный процесс. Позже было
установлено, что распространение резистентности
к антибиотикам происходит при контактировании
клеток друг с другом (рис. II.14). Было показано,
что резистентные к антибиотикам клетки содержат
205
ВВЕДЕНИЕ
Чужеродная ДНК
Векторная вирусная ДНК
Разрезание
Смешивание и
лигирование
Бактериальный газон
Включение в вирусные
частицы, растущие на газоне
бактериальных клеток
Бляшки
Вирус с фрагментом d
Вирус с фрагментом а
РИС. II.13.
Вирус с фрагментом b
Вирус с фрагментом c
генетические элементы – плазмиды, не связанные
с хромосомной ДНК, способные реплицироваться
независимо от хромосомы и передаваться от клетки
к клетке при их контактировании. Именно такие
внехромосомные элементы и содержат гены, которые придают клеткам наследуемую устойчивость
к одному или нескольким антибиотикам. Они получили название факторов резистентности, или R-факторов.
Механизм распространения R-факторов стал
Молекулярное клонирование чужеродной
ДНК в вирусном (фаговом) векторе.
более понятен после того, как был установлен способ переноса генетической информации от одной
клетки к другой во время конъюгации бактерий. Из
рис. II.1 видно, что перенос генетического материала осуществляется благодаря способности донорных клеток реплицировать и переносить свою
геномную ДНК через конъюгационный мостик
в клеки реципиента. Штаммы Е. coli, являющиеся
донорами, содержат в составе своего генома ДНК
плазмидного происхождения, названную фактором
206
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
Бактерии
резистентные к антибиотику
чувствительные к антибиотику
Потомство, чувствительное
к антибиотику
Конъюгация и
перенос плазмиды
Потомство, резистентное
к антибиотику
Резистентные клетки
РИС. II.14.
Распространение плазмиды, несущей гены резистентности к лекарственному препарату, при переносе ее из
клетки в клетку.
Резистентное потомство
фертильности, или F-фактором. Такие донорные
хромосомы образуются после приобретения клетками F-фактора и рекомбинации между этой плазмидой и хромосомой клетки. В присутствии интегрированного F-фактора облегчаются конъюгация
и перенос хромосомы. Перенос инициируется в сайте интеграции F-фактора. Благодаря способности
плазмиды встраиваться в ДНК во многих сайтах
разные штаммы инициируют перенос в различных
сайтах хромосомы E. coli (рис. II.1 и II.2). В некоторых случаях F-фактор остается в клетках в виде независимого внехромосомного элемента – F-плазмиды
(рис. II.15). Такие клетки, обозначаемые F + , перено-
сят плазмиду F в реципиентные клетки таким же
способом, как в случае переноса R-факторов.
R- и F-факторы представляют собой ковалентно
замкнутые кольцевые молекулы двухцепочечной
ДНК. Оба они содержат гены, обеспечивающие их
репликацию в виде автономных плазмид и их перенос при контакте с соответствующими реципиентами. R-факторы несут также гены резистентности
к антибиотикам. Одни такие гены изменяют реакцию клетки на антибиотик, другие индуцируют
образование белков, вызывающих деградацию или
модификацию определенных антибиотиков. Например, одна из R-плазмид кодирует β-лактамазу, обес-
207
ВВЕДЕНИЕ
F
+
РИС. II.15.
Перенос F-фактора между бактериями при конъюгации.
Бактерия F+
Конъюгация
Бактерия F
–
Разделение
Репликация
+
Перенос
печивающую устойчивость к ампициллину благодаря деградации этого антибиотика. Устойчивость
к хлорамфениколу обусловливается ацетилированием этого антибиотика. Ацетилирование катализируется ферментом хлорамфеникол-ацетилтрансферазой, кодируемым плазмидой.
Плазмидные ДНК легко выделить в больших
количествах и получить в очищенном виде, что
позволяет исследовать их потенциальную способность служить векторами для введения в клетки
новых сегментов ДНК. Соединение плазмидной
ДНК с соответствующим образом модифицированными вставками можно осуществить in vitro аналогично тому, как это происходит в случае соединения вставок с фаговыми векторами (рис. II.12).
В этих экспериментах большую роль сыграл опыт
осуществления трансформации клеток с помощью
ДНК. Были разработаны методы включения очищенной плазмидной ДНК в клетки соответствующих бактерий-хозяев. Благодаря наличию в таких
плазмидах генов резистентности к антибиотикам
можно провести отбор клеток, содержащих R-плазмиду в качестве стабильно реплицирующейся структуры. Такие клетки живут и делятся в присутствии
антибиотика, а клетки, утратившие эту плазмиду,
погибают. Рекомбинантные плазмидные ДНК сохраняются в присутствии антибиотика как некие
автономно реплицирующиеся геномы во время последующих клеточных делений. При клонировании
образуются колонии клеток, содержащих уникальную рекомбинантную ДНК, потому что каждая
клетка хозяина содержит только одну плазмиду.
Поскольку размер многих плазмидных векторов не
превышает нескольких тысяч пар нуклеотидов, обогащение по сегментам эукариотической ДНК в этом
случае оказывается более высоким, чем при использовании фаговых векторов. Именно плазмиды
оказались первыми векторами, с помощью которых
было осуществлено молекулярное клонирование в
клетках бактерий.
F
+
ферментов, которые узнают специфические короткие нуклеотидные последовательности и разрезают
обе цепи двойной спирали ДНК в сайте узнавания
или на некотором расстоянии от него. В открытии
этих ферментов ключевую роль сыграло наблюдение, сделанное примерно 30 лет назад. Оно состояло
в том, что бактериофаг, выращенный в клетках
одного штамма, инфицируя клетки других штаммов
этого же вида, часто растет очень плохо. Более того,
выделенные после такой неэффективной инфекции
бактериофаги в свою очередь плохо развиваются
в исходных клетках (рис. II.16). Этот феномен не
связан с генотипом фага и был объяснен тем, что
в фаге происходят какие-то модификации, контролируемые хозяином. Было высказано предположение, что некий фаговый компонент, необходимый
для репликации, специфическим образом модифиБактериофаг, выращенный
в штамме А
Выход=100%
Выход=0,001%
Штамм А
Выход = 0,001%
Штамм В
Рестриктирующие эндонуклеазы
Одним из наиболее важных результатов генетического изучения бактерий и их бактериофагов
явилось открытие рестриктирующих эндонуклеаз –
Выход=100%
РИС. II.16.
Пример контролируемой хозяином рестрикции.
208
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
Полностью метилированная ДНК
РИС. II.17.
Роль модифицирующей метилазы и рестриктирующей эндонуклеазы в рестрикции,
контролируемой хозяином.
Инфицирование фагом,
выращенным в другом хозяине
Фаговая ДНК
Модификация
с помощью
метилазы
Рестриктирующая
эндонуклеаза
неспособна разрезать
метилированную
фаговую ДНК
Рестриктирующая
эндонуклеаза разрезает
неметилированную ДНК
Неспецифическая
нуклеаза расщепляет
образовавшиеся
фрагменты
Вирус
Раствор ДНК
Обработка
рестриктирующей
эндонуклеазой 2
Обработка
рестриктирующей
эндонуклеазой 1
Электрофоретическое
разделение фрагментов и
окрашивание ДНК в геле
РИС. II.18.
Рестриктирующие эндонуклеазы разрезают молекулу ДНК с образованием специфических наборов фрагментов, которые можно разделить по
размерам с помощью гель-электрофореза.
Размер
фрагмента
Направление
электрофореза
Размер
фрагмента
209
ВВЕДЕНИЕ
цируется в клетках хозяина, так что фаг может
завершить репликацию при повторном инфицировании того же штамма. При этом его рост в неродственном штамме ограничивается, поскольку
последний не содержит соответствующей системы
модификации.
Было доказано, что модифицируемым фаговым
компонентом является ДНК, а неспособность фага
реплицироваться в неродственном штамме обусловлена деградацией инфицирующей фаговой ДНК
(рис. II.17). Расщепление ДНК инициируется внесением нескольких разрывов в высокоспецифичных
сайтах, после чего происходит полная неспецифическая деградация. Модификацией, защищающей
некоторые инфицирующие фаговые ДНК, а также
геном клетки от разрывов, является штамм-специфичное метилирование ДНК. С помощью генетических и биохимических исследований установлено, что метилирование ДНК происходит в строго
RE 1
RE 1
RE 2
специфических участках. Рестрикция осуществляется
эндонуклеазами, которые узнают аналогичные короткие специфические последовательности, лишенные метильных групп. Системы модификации
и рестрикции всегда соответствуют друг другу, т.е.
метилирование и разрезание происходят в одних
и тех же последовательностях ДНК. В каждой системе в качестве мишеней для штамм-специфичных
систем рестрикции-модификации используются
свои короткие последовательности ДНК. Метилированная ДНК не разрезается по этой последовательности родственной рестриктирующей эндонуклеазой. Аналогично рестриктирующие эндонуклеазы
разрезают только те ДНК, у которых не модифицированы соответствующие сайты рестрикции.
Регуляция системы рестрикции и модификации
осуществляется с помощью родственных наборов
генов, и такие парные системы имеются у многих
видов бактерий, бактериофагов и плазмид.
RE 2
Разрезание ДНК
рестриктирующими
эндонуклеазами
RE1 и RE2
Плазмида
Плазмида
RE 2
RE 1
Рекомбинация
РИС. II.19.
Многие рестриктирующие эндонуклеазы
разрезают молекулу ДНК несимметрично, в результате чего образуются
взаимно комплементарные одноцепочечные концы. Любые два сегмента
ДНК, имеющие такие концы, могут рекомбинировать in vitro. Если один из
сегментов способен реплицироваться в
соответствующей клетке-хозяине, то вся
рекомбинантная молекула может быть
клонирована и амплифицирована. В
приведенном примере плазмидные ДНК
соединены с двумя фрагментами, полученными с помощью рестриктирующих
эндонуклеаз (верхняя часть рисунка).
210
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
При анализе генетической и физической организации сложных геномов особенно важными оказываются два свойства рестриктирующих эндонуклеаз. Первое связано с огромным диапазоном специфичностей, проявляемых в совокупности различными рестриктирующими эндонуклеазами, что позволяет разрезать практически любую ДНК на дискретные фрагменты самыми разными способами.
Эти фрагменты можно разделить по размерам с помощью гель-электрофореза (рис. II.18). Распределение фрагменов по размерам, получающееся при
расщеплении данной эндонуклеазной ДНК в специфических сайтах, является своего рода «отпечатком
пальцев», характерным для этой ДНК. Второе свойство эндонуклеаз рестрикции связано со способностью многих из них осуществлять несимметричные разрезы двухцепочечной ДНК, в результате
чего образуются фрагменты с комплементарными
одноцепочечными концами (рис. II.19). Это позволяет проводить рекомбинацию ДНК in vitro. Любые
два сегмента ДНК со взаимодополняющими концами могут объединиться, в результате чего происходит встраивание фрагментов в фаговую, плазмидную ДНК или другие потенциальные векторы.
Такие специфические комбинации «вектор–вставка»
можно получить в чистом виде путем молекулярного клонирования и амплификации в соответствующих хозяйских клетках (рис. II.12).
В последующих главах мы рассмотрим те уникальные свойства рестриктирующих эндонуклеаз,
благодаря которым с помощью молекулярного клонирования удалось выделить специфические гены
даже из наиболее сложных геномов. Вскоре после
этого была получена детальная информация
о структуре генов и их регуляторных элементов
и построены подробные карты их расположения
в геноме. Препятствия, которые стояли на пути
молекулярной генетики эукариотических геномов,
были тем самым устранены.
Развитие методологии рекомбинатных ДНК
и молекулярного клонирования само по себе привело к созданию новых областей биологических
исследований. Однако полная реализация этих новых возможностей зависела от других проводимых
одновременно разработок: развития методов фракционирования, которые позволяли бы разделять
фрагменты ДНК, лишь незначительно различающиеся по длине (рис. II.18); создания относительно
простых и быстрых процедур секвенирования ДНК
длиной несколько тысяч нуклеотидов; получения
специфически модифицированных генов путем внесения мутаций в их клонированные копии in vitro;
генетической трансформации клеток, тканей и всего
организма путем введения клонированных генов
в соответствующие системы.
В четырех главах, составляющих часть II, описаны приемы и методы конструирования, клонирования, отбора и получения характеристик рекомбинантных ДНК. Приведенный материал не может
служить лабораторным руководством. Основной
акцент делается лишь на рассмотрении ключевых
положений. Часто обращается внимание на ранние
результаты, благодаря которым был разработан
тот или иной метод. Ученые, получившие эти результаты, не могли предвидеть, как они скажутся
на развитии технологии рекомбинантных ДНК. Теперь мы знаем, что именно успехи в молекулярной
генетике прокариот и в изучении ферментов,
осуществляющих синтез и деградацию нуклеиновых
кислот, открыли путь к исследованию эукариотических геномов.
Глава 4
ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
Возможность проведения различных манипуляций с ДНК in vitro всецело зависит от наличия
очищенных ферментов, которые специфическим
образом разрезают, модифицируют и соединяют
молекулы. В настоящее время отсутствуют чисто
химические методы, с помощью которых можно
было бы осуществлять перестройку молекул ДНК
с такими селективностью и разнообразием, которые
характерны для ферментативных реакций. В то же
время даже с помощью довольно небольшого числа
ферментов можно получать рекомбинантные молекулы ДНК. Большинство этих ферментов были
открыты при обстоятельствах, не связанных с их
использованием при манипулировании с молекулами ДНК. На самом деле каждый фермент играет
важную роль катализатора в том или ином химическом процессе, протекающем в организме, из
которого он выделен. Использование ферментов
в качестве инструмента при манипулировании
с ДНК зависит, в частности, от их доступности
и стабильности, а особенно от их чистоты, и прежде
всего от того, свободны ли они от примесей,
влияющих на ферментативную активность.
ты, имеющие свободные концы, при этом расщепление идет либо непосредственно с концов цепей, либо
вблизи них. Разные экзонуклеазы расщепляют цепь
предпочтительно либо с 5'-, либо с 3'-конца, но
иногда они не проявляют такой специфичности.
Эндонуклеазам свободные концы не требуются,
поэтому данные ферменты могут гидролизовать
кольцевые молекулы ДНК. Разрезание осуществляется по внутренним фосфодиэфирным связям, при
этом образуются фрагменты разной длины. С помощью экзонуклеаз тоже могут образовываться
короткие полинуклеотидные фрагменты, однако конечным продуктом во многих случаях являются
нуклеозидмонофосфаты, поскольку экзонуклеазы
осуществляют гидролиз, отщепляя последовательно
один остаток за другим.
Наконец, нуклеазы отличаются одна от другой
по тому, с какой стороны от межнуклеотидного
фосфодиэфирного мостика осуществляется гидролиз (рис. 4.1). Одни ферменты делают разрез между
фосфатом и 3'-гидроксильной группой с образованием 5'-фосфомоноэфирных продуктов, другие –
между фосфатом и 5'-гидроксильной группой, в ре-
4.1. НУКЛЕАЗЫ
а. Общие свойства
Нуклеазы позволяют специфическим образом
модифицировать молекулы ДНК и РНК. Каждый
фермент может быть отнесен к тому или иному
классу в соответствии с его специфичностью или
типом реакции, которую он катализирует. Так, ряд
ферментов, подобно рестриктирующим эндонуклеазам, действует только на ДНК. Другие, подобно
панкреатической РНКазе, гидролизуют только РНК
(табл. 4.1). Есть ферменты, которые используют
в качестве субстратов как ДНК, так и РНК. Одни
нуклеазы предпочтительно действуют либо на двухцепочечные, либо на одноцепочечные полинуклеотидные субстраты, другие не проявляют такой выраженной предпочтительности.
Нуклеазы можно также разделить на две следующие категории: экзонуклеазы и эндонуклеазы. Экзонуклеазы расщепляют полинуклеотидные субстра-
Гидролиз связи между
фосфатом и 3'-гидроксилом
с образованием
5'-фосфомоноэфирных групп
РИС. 4.1.
Гидролиз связи между
фосфатом и 5'-гидроксилом
с образованием
3'-фосфомоноэфирных групп
Нуклеазы могут расщеплять полинуклеотидную цепь
с одной или с другой стороны от фосфодиэфирного
мостика. Каждый фермент проявляет определенную
специфичность в этом отношении.
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
212
Таблица 4.1. Типичные нуклеазы
Название 1)
Источник
Специфичность
Предпочитаемая 2)
структура
Эндо или экзо
Продукт 3)
*Bal 31
Alteromonas espejiana
ДНК
ДНК
о. ц.
д.ц.
Эндо
5'-р(Nр)nН
Е. coli
Е. coli
Е. coli
ДНК
ДНК
ДНК
о.ц.
д.ц.
о.ц.
Экзо (3'–>5')
Экзо (3'–>5')
Е. coli (λ-фаг)
Проростки
Phaseolus aureus
Neurospora crassa
ДНК
д.ц.
ДНК, РНК о.ц.
Экзо (5'–>3')
Эндо
5'-NMP
5'-p(Np)nN
ДНК, РНК о.ц.
Эндо
5'-p(Np)nN
Крупный рогатый
скот
Крупный рогатый
скот
Клетки
Ретровирус
Aspergillus oryzae
Crotalus adamanteus
ДНК
о.ц., д.ц.
Эндо
5'-p(Np)nN
РНК
о.ц.
Эндо
(Np)nCU-p-3'
РНК•ДНК д.ц.
РНК•ДНК д.ц.
ДНК, РНК о.ц.
ДНК, РНК о.ц.
Эндо
Экзо (3'–>5')
Эндо
Экзо (3'–>5')
5'-p(Np)nN
5'-p(Np)nN
5'-p(Np)nN
5'-NMP
Крупный рогатый
скот
Staphylococcus
aureus
ДНК, РНК о.ц.
Экзо (5'–>3')
3'-NMP
РНК, ДНК о.ц.
Эндо
(Np)nN-p-3'
Ехо I
Ехо III
*Ехо VII
λ-Экзонуклеаза
*Нуклеаза
Phaseolus aureus
*Нуклеаза
Neurospora crassa
Панкреатическая
ДНКаза I
Панкреатическая
РНКаза
*РНКаза Н
*РНКаза Н
*Нуклеаза S1
Фосфодиэстераза
змеиного яда
Фосфодиэстераза
селезенки
Стафилококковая
нуклеаза
1)
2)
3)
5'-NMP
5'-NMP
5'-NMP
5'-p(Np)nN
Ферменты, отмеченные звездочкой, описаны в тексте.
О.ц. - одноцепочечная ДНК, д.ц. - двухцепочечная.
N - любой нуклеотид; (Np)n - полинуклеотидная цепь, содержащая п остатков.
зультате чего образуются продукты с 3'-фосфомоноэфирными концами.
Большинство ферментов, перечисленных в
табл. 4.1, упоминаются в тексте этой книги. Нуклеазы, отмеченные звездочкой, используются как
рутинные реактивы в экспериментах по получению
рекомбинантных молекул ДНК и поэтому рассматриваются более детально.
б. Нуклеазы, специфичные
в отношении одноцепочечной ДНК
Эндонуклеазы. Некоторые эндонуклеазы гидролизуют одноцепочечные молекулы ДНК примерно
в тысячу раз быстрее, чем двухцепочечные. Такая
специфичность используется во многих экспериментах – при конструировании рекомбинантных ДНК,
при гетеродуплексном анализе и даже при анализе
экспрессии генов. Некоторые реакции, катализируемые подобными эндонуклеазами, представлены на
рис. 4.2.
Несколько разных эндонуклеаз такого типа были
достаточно хорошо очищены и охарактеризованы,
чтобы их можно было использовать в качестве
реактивов. Одна из них, нуклеаза S1, получена из
высушенных препаратов плесневого гриба Aspergillus oryzae; источниками двух других широко используемых ферментов являются Neurospora и Mung
beans. Каждый из этих трех ферментов проявляет
максимальную активность и точность распознавания одноцепочечных и двухцепочечных молекул при
определенных условиях. Все три фермента гидролизуют как ДНК, так и РНК. При разрыве фосфодиэфирных связей с помощью этих ферментов образуются 5'-монофосфатные и 3'-гидроксильные концы.
Экзонуклеазы. Экзонуклеаза E. coli exo VII специфична в отношении одноцепочечных ДНК. Она
обладает необычной экзонуклеазной активностью
в том смысле, что инициирует отщепление как с 5'-,
так и с 3'-концов цепи, в то время как наиболее
известные экзонуклеазы специфичны к какому-то
одному концу (см., однако, описание экзонуклеазы
213
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
РИС. 4.2.
А
Некоторые реакции, катализируемые эндонуклеазами, специфичными в отношении одноцепочечных участков. А. Отщепление одноцепочечных хвостов у дуплексной ДНК. Б. Разрезание дуплексной ДНК с локально расплетенным участком на два фрагмента.
В. Разрезание дуплексной ДНК со
шпилькой на конце с образованием одного двухцепочечного
дуплекса. Г. Разрезание дуплекса
с пробелом с образованием двухцепочечных спиральных сегментов. Д. Разрезание дуплексной
ДНК с одноцепочечной петлей в
середине на двухцепочечные фрагменты.
Б
В
Г
Д
Bal 31 в разд. 4.1.в). Рис. 4.2, A и 4.3 иллюстрируют
действие exo VII на две разные дуплексные ДНК.
Хотя ехо VII распознает концы цепей, она не отщепляет последовательно по одному нуклеотиду. Продуктами гидролиза отдельных цепей экзонуклеазой
ехо VII являются олигонуклеотиды длиной примерно 25 мономерных единиц, которые содержат
5'-фосфомоноэфирные концевые группы.
в. Нуклеаза Bal 31
Псевдомонада Alteromonas espejiana секретирует
единственную дезоксирибонуклеазу, получившую
название Bal 31. В отношении одноцепочечной ДНК,
в том числе одноцепочечных участков двухцепочечной ДНК, Bal 31 ведет себя как эндонуклеаза,
действуя аналогично другим эндонуклеазам, специфичным к одноцепочечным ДНК. Однако в отношении интактной двухцепочечной ДНК этот фермент проявляет экзонуклеазную активность, по-ви-
димому, благодаря тому, что он способен распознавать локальные одноцепочечные участки (или места
нестабильности в дуплексах). Ваl 31 разрезает обе
цепи на обоих концах дуплекса, т.е. осуществляет
деградацию одновременно в направлениях 3'–>5'
и 5'–>3'. В результате двухцепочечная молекула
постепенно укорачивается (рис. 4.4.). Если эмпирически оценить скорость этого процесса, то с помощью
фермента Ваl 31 можно получать фрагменты ДНК
нужной длины. Хотя укорочение разных молекул
ДНК происходит несинхронно, получается набор
фрагментов, длина которых близка к заданной.
В результате исчерпывающего гидролиза с помощью Bal 31 промежуточные олигонуклеотидные
продукты расщепляются до 5'-мононуклеотидов.
Bal 31
exo VII
Bal 31
РИС. 4.3.
Реакция, катализируемая ферментом ехо VII. Экзонуклеаза отщепляет одноцепочечные 5'- и 3'-концы с освобождением олигонуклеотидов длиной около 25 остатков.
РИС. 4.4.
Разрезание ферментом Bal 31 двухцепочечной линейной ДНК.
214
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
г. РНКазы Н
Существует группа ферментов, получивших название РНКазы Н потому, что они специфически
расщепляют цепь РНК в гибридном дуплексе РНК–
ДНК. РНКаза Н E. coli представляет собой эндонуклеазу, продуктами действия которой являются
олигорибонуклеотиды с 5'-фосфомоноэфирными
концами. Этот фермент широко используется как
реактив (разд. 4.7). Клетки эукариот тоже содержат
подобную эндонуклеолитическую РНКазу Н. РНКаза
Н-экзонуклеолитическая активность присуща экзонуклеазе III E. coli (табл. 4.1) и обратным транскриптазам, кодируемым ретровирусами (разд. 4.7).
Экзонуклеаза III расщепляет РНК до 5'-нуклеозидмонофосфатов в направлении 3'–>5', а продуктами
гидролиза цепи РНК с помощью обратной транскриптазы являются 5'-фосфорилированные олигорибонуклеотиды длиной от двух до десяти нуклеотидов.
4.2. ЭНДОНУКЛЕАЗЫ РЕСТРИКЦИИ
Эволюция наделила различные виды бактерий
уникальными эндонуклеазами, позволяющими им
отличать их собственную ДНК от чужеродной. Тем
самым природа снабдила ученых богатым набором
высокоспецифичных реактивов для расщепления
ДНК. При изучении ДНК большое значение имеют
две важные особенности рестриктирующих эндонуклеаз. Первая связана с замечательной способностью
фермента узнавать специфические короткие нуклеотидные последовательности в ДНК. Вторая состоит
в том, что существует большое количество различных эндонуклеаз рестрикции, каждая из которых
узнает специфическую последовательность.
а. Три типа эндонуклеаз рестрикции
Эндонуклеазы типов I и II. Ферменты, относящиеся к группе эндонуклеаз типов I и II,– это сложные белки, обладающие активностями рестриктирующей эндонуклеазы и метилазы. Эти интересные
ферменты не используются, однако, при конструировании рекомбинантных молекул ДНК. Ферменты
типа I связываются с ДНК в специфических участках и затем производят двухцепочечные разрезы на
разном расстоянии от сайтов узнавания, варьирующем от 400 п.н. до 7 т.п.н. Для осуществления
ферментативного гидролиза ДНК необходимы
Mg 2 + , ATP и S-аденозилметионин. Последний активирует фермент. Разрезание сопровождается гидролизом АТР, при этом фермент утрачивает эндонуклеолитическую активность, но сохраняет АТРазную. Таким образом, эндонуклеазы типа I являются
ДНК-зависимыми АТРазами. Кроме того, они
представляют собой сайтспецифические метилазы,
катализирующие образование 6-метиладениновых
остатков в сайте узнавания. Например, сайтом узнавания для фермента из E. coli K12 является
где N – любое основание, a N – комплементарное
ему основание. Эндонуклеаза разрезает цепь на
значительном расстоянии от сайта узнавания, но
при этом метилирование с образованием 6-метиладенина происходит в пределах этого сайта (остатки А, помеченные точками). Эндонуклеазная активность проявляется только при наличии полностью
неметилированного сайта. Сайт узнавания для фермента E. coli K12 состоит из двух коротких
специфических олигонуклеотидов, разделенных
шестью-восемью неспецифическими парами оснований. Такая структура типична для сайтов узнавания
ферментов типа I, обнаруженных у различных
штаммов бактерий. Специфические олигонуклеотидные последовательности для разных ферментов
различаются, но метилированные остатки А всегда
находятся в одинаковых позициях.
Родственные системы рестрикции-модификации
типа I кодируются аллельными локулами геномов
различных кишечных бактерий (например, Е. coli
и Salmonella typhimurium). С каждой системой связаны три сцепленных гена: hsdR, hsdM и hsdS,
расположенные в порядке, соответствующем порядку транскрипции. Полипептидные продукты hsdM
и hsdS транслируются с одной двухцистронной
мРНК и вместе составляют метилазу. Первый из
них обладает метилазной активностью, а второй
осуществляет сайтспецифическое узнавание. Продукт гена hsdR обладает эндонуклеазной активностью. Все три полипептида содержатся в различных пропорциях в активных препаратах ферментов
типа I.
Ферменты типа III, так же как и эндонуклеаза
типа I, обладают нуклеазной и метилазной активностями. Однако несмотря на то, что ферменты
типа III активируются S-аденозилметионином и для
своей работы требуют АТР, они не катализируют ее
гидролиза. Эндонуклеазы типа III делают двухцепочечные разрезы в ДНК на расстоянии примерно
25 п.н. от своих сайтов узнавания. В присутствии
АТР и S-аденозилметионина те же ферменты катализируют сайтспецифическое метилирование. Ферменты типа III – гетеродимерные белки. Их субъединицы кодируются двумя сцепленными генами,
локализованными у некоторых штаммов Е. coli во
внехромосомных геномах (фаговой ДНК или плазмиде). Каждый такой ген представляет собой отдельную транскрипционную единицу. Один генный
215
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
продукт узнает специфическую последовательность
и обладает метилазной активностью, другой выполняет эндонуклеазную функцию.
Поскольку ферменты типа I не разрезают молекулы ДНК на репродуцирующиеся фрагменты и эндонуклеазные активности ферментов типа I и III
конкурируют с метилированием, ни один из них не
используется в качестве реагента при получении
рекомбинантных ДНК.
Эндонуклеазы типа II. Рестриктирующие эндонуклеазы типа II являются основным инструментом
при конструировании рекомбинантных молекул
ДНК и при анализе структуры ДНК. Эти ферменты
способны узнавать специфические короткие нуклеотидные последовательности и связываться с ними,
но в отличие от эндонуклеаз типов I и III они
производят двухцепочечные разрезы по специфическим фосфодиэфирным связям либо в пределах
самого сайта узнавания, либо на вполне определенном небольшом расстоянии от него. Один и тот же
фермент разрезает данную молекулу ДНК с образованием одинаковых наборов фрагментов. Длина
фрагментов определяется расстоянием между специфическими последовательностями, узнаваемыми
этим ферментом. Ферменты типа II гидролизуют
фосфодиэфирные связи между 3'-гидроксильной
группой и фосфатом, в результате чего образуется
5'-фосфомоноэфирная группа с одной стороны от
разрыва и 3'-гидроксильная группа – с другой. Для
функционирования ферментов необходим двухваЭтап 1
EcoRI
Диссоциация
РИС. 4.5.
Этап 2
Реассоциация
Сайт узнавания и разрезания для рестриктирующей
эндонуклеазы Eco RI. Разрезание происходит в два этапа: сначала гидролизуется одна цепь, потом - другая.
При обычных условиях продуктами реакции являются
два дуплексных фрагмента с комплементарными одноцепочечными концами. В условиях, способствующих
стабилизации водородных связей между четырьмя нуклеотидами из разных цепей (например, при понижении
температуры), фрагменты могут реассоциировать.
2+
лентный катион, обычно Mg , но ни АТР, ни
S-аденозилметионин не требуются.
б. Типичная рестриктирующая
эндонуклеаза типа II
Эндонуклеаза Eco RI. Широко используемая рестриктирующая эндонуклаза Eco RI разрезает ДНК
в тех местах, где встречается последовательность
5'-GAATTC-3' (рис. 4.5). Как и в случае других
рестриктирующих эндонуклеаз типа II, эта последовательность является палиндромом, т.е. в обеих
цепях точно напротив друг друга находятся одинаковые последовательности, читаемые в направлении
5'–>3'. Eco RI гидролизует фосфодиэфирные связи
между остатками G и А в каждой цепи. Поскольку
эндонуклеаза Eco RI разрезает обе цепи в том месте,
где встречается палиндромная последовательность
5'-GAATTC-3', молекула ДНК разрезается на характерный для нее набор фрагментов («фингерпринт» –
«отпечатки пальцев», рис. 4.6).
Липкие концы. Эндонуклеаза Eco RI производит
ступенчатые двухцепочечные разрезы, при этом
у образующихся фрагментов ДНК на концах образуются короткие комплементарные одноцепочечные
хвосты из четырех оснований – 5'-ААТТ-3' (рис. 4.5).
В зависимости от ионной силы раствора и температуры эти комплементарные хвосты либо остаются
спаренными, либо денатурируют, и тогда образуются отдельные фрагменты с короткими одноцепочечными выступами на 5'-концах. При соответствующих условиях комплементарные хвосты воссоединяются (рис. 4.5). Одноцепочечные концы, образующиеся при расщеплении ДНК эндонуклеазой
Eco RI, получили название липких, поскольку они
способны спариваться (как бы слипаться) друг
с другом. Важным следствием образования ступенчатых разрывов является то, что фрагменты, получающиеся в результате обработки эндонуклеазой
Eco RI двух разных ДНК (например, ДНК E. coli
и дрожжей), могут соединяться с помощью липких
концов. При этом различия, затрагивающие двухцепочечные спиральные сегменты указанных ДНК, на
процесс соединения не влияют.
Фермент. В отличие от рестриктирующих эндонуклеаз типов I и III ферменты типа II, подобные
Eco RI, не катализируют метилирования. Метилазную активность проявляет другой белок. Активная
эндонуклеаза Eco RI представляет собой димер, состоящий из двух идентичных полипептидных цепей
с мол. массой 31000. Исходя из гомодимерной
структуры можно было бы ожидать, что фермент
будет действовать симметрично на идентичные
последовательности двух частей сайта узнавания
и разрезать обе цепи одновременно. Однако на
самом деле гидролиз происходит последовательно.
216
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
E
E
E
E
E
РИС. 4.6.
Схематическое изображение разрезания
эндонуклеазой Eco RI протяженной двухцепочечной ДНК, содержащей несколько сайтов узнавания для этого фермента (E).
EcoRI
Белок взаимодействует с участком около десяти пар
оснований; шесть из них находятся в пределх сайта
узнавания, остальные являются фланкирующими.
Именно эти фланкирующие последовательности,
по-видимому, определяют выбор цепи, которая
будет разрезана первой. Кроме того, фланкирующие пары оснований влияют на общую скорость
разрезания в данном сайте узнавания, так что
в разных сайтах одной молекулы ДНК гидролиз
осуществляется с разной скоростью. Были получены
кристаллы комплекса Eco RI и олигонуклеотида
5'-TCGCGAATTCGCG-3' и проведен их рентгеноструктурный анализ. Это позволило в деталях выяснить способ взаимодействия данного фермента
и ДНК. Было установлено, что между двумя остатками аргинина и одним глутаматом (на каждой
субъединице), с одной стороны, и парами оснований
в сайте узнавания – с другой, образуются водородные связи, в результате чего происходит частичное
раскручивание В-ДНК. О свойствах других рестриктирующих эндонуклеаз типа II известно значительно меньше, но, по-видимому, они аналогичны свойствам Eco RI.
в. Различные группы
рестриктирующих эндонуклеаз
типа II
Большой каталог реактивов. На рис. 4.7–4.9
представлены некоторые из примерно 400 уже описанных рестриктирующих эндонуклеаз. У всех этих
ферментов обнаружено около 90 разных сайтов
узнавания. Каждый из ферментов получен из определенного прокариотического организма, что
и отражено в его названии. Так, Eco RI ведет свое
происхождение из штамма Escherichia coli К12;
Hae II и Hae III – из Haemophilus aegyptius; Bam HI –
из Bacillus amyloliquefaciens штамма H; Mbo I и
Mbo II – из Moraxella bovis и т.д. Два разных фермента, имеющие одинаковые сайты узнавания, называются изошизомерами. Однако изошизомеры не
обязательно делают разрез в одном и том же месте;
сравните, например, Xma I и Sma I на рис. 4.7 и 4.8
соответственно. Чтобы упростить описание рестриктазных сайтов широко применяемых ферментов,
мы используем набор обозначений, представленных
в табл. 4.2.
Палиндромные сайты узнавания и разрезания.
Эндонуклеаза Eco RI – одна из многих рестриктирующих эндонуклеаз типа II (рис. 4.7), которые
узнают различные палиндромные нуклеотидные последовательности и делают разрезы, в результате
чего образуются фрагменты с комплементарными
одноцепочечными хвостами. В пределах этой группы можно выделить несколько разновидностей ферментов. Например, Eco RI, Hind III и некоторые
другие эндонуклеазы узнают последовательности из
шести пар оснований; эндонуклеаза Hinf I узнает
пять пар оснований, из которых центральным остатком (на рис. 4.7 он обозначен как N) может быть
любой из четырех нуклеотидов. Эднонуклеаза Bgl I
узнает шесть специфических нуклеотидных остатков, но они должны быть разделены в середине
любыми другими пятью парами оснований. Эндонуклеаза Not I имеет сайт узнавания протяженностью восемь пар оснований; такие ферменты, как
Taq I и Mbo I, имеют сайты узнавания из четырех
Таблица 4.2. Обозначения рестриктазных сайтов
наиболее широко используемых ферментов
Рестриктирующая Обозначение
эндонуклеаза
АlиI
AvaI
BamHI
ВсlI
ВglI
ВglII
ClaI
DdeI
EcoRI
EcoRII
EcoRV
HaeII
HaeIII
HincII
HindIII
HinfI
HpaI
HphI
A1
A
В
Bc
Bg
B2
С
D
E
E2
E5
He
На
Hc
H
Hf
HI
Hp
Рестриктирующая эндонуклеаза
Обозначение
KpnI
MboI
MbcII
MspI
PstI
PvuI
PvuII
SacI
SalI
Sau3A
SmaI
SphI
SstI
TaqI
XbaI
XhoI
XmaIII
К
M1
M2
M
P
Pu
Pv
Sc
S
S3
Sm
Sp
Ss
Т
X
Xh
Xm
217
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
нуклеотидов. Другая известная особенность касается свойств одноцепочечных концов, образующихся
при действии различных рестриктирующих эндонуклеаз (рис. 4.7). Эндонуклеазы Eco RI, Hind III, Mbo I
и Сlа I образуют одноцепочечные хвосты, состоящие
Фермент
Фермент
Сайт узнавания
и разрезания
Alu I
Сайт узнавания и разрезания
Нае III
BamHl
ВсlI
Нра I
ВglI
Sma I
СlaI
EcoRl
НаеII
HindIII
HinfI
HpaII
MboI &,
Sau3A
MspI
NotI
PstI
TaqI
XmaI
РИС. 4.7.
Группа рестриктирующих эндонуклеаз типа II, разрезающих палиндромные последовательности с образованием липких концов. Стрелками указаны точки разрезов. Фосфодиэфирный мостик, обозначаемый обычно
буквой «р», на этой и последующих диаграммах не
указан. Очевидно, что при разрезании ДНК рестриктирующими эндонуклеазами всегда образуются 5'-концевой фосфомоноэфир и 3'-концевой гидроксил (рис. 4.1).
N - любое основание. N - комплементарное ему основание. Буквами R и Y обозначены один из пуринов и один
из пиримидинов соответственно.
РИС. 4.8.
Группа рестриктирующих эндонуклеаз типа II, разрезающих палиндромные последовательности с образованием тупых концов.
из 5'-концевых остатков каждой цепи, а эндонуклеазы Pst I и Hae II – из 3'-остатков.
Эндонуклеазы, имеющие различные сайты узнавания и разрезания, часто образуют идентичные
липкие концы. Например, под действием эндонуклеаз Mbo I, Bcl I и Bam HI образуются 5'-концевые
5'-GATC-3'. В результате фрагменты, получающиеся
при расщеплении данной ДНК любым из этих
ферментов, при смешивании и отжиге будут соединяться друг с другом. Однако фрагменты, получающиеся из различных ДНК при разрезании эндонуклеазой Bgl I, вряд ли будут соединяться при
отжиге, поскольку одноцепочечные хвосты могут
содержать любую последовательность из трех нуклеотидов.
Другие рестриктирующие эндонуклеазы типа II
(рис. 4.8) также узнают специфические палиндромные нуклеотидные последовательности, но разрезают фосфодиэфирный мостик в середине узнаваемой последовательности, в результате чего образуются фрагменты ДНК с тупыми двухцепочечными
концами.
Непалиндромные сайты узнавания с разрезанием
на некотором расстоянии от них. Ферменты типа II,
но другой разновидности (рис. 4.9) тоже узнают
специфические нуклеотидные последовательности,
но гидролизуют фосфодиэфирные мостики вне этих
последовательностей. При этом узнаваемая последовательность не является палиндромом. В этих
случаях рестриктирующие эндонуклеазы, по-видимому, «отсчитывают» точное число пар оснований
от узнаваемой последовательности и затем разрезают цепи. Механизм отсчета таков, что места
гидролиза разных цепей смещены одно относитель-
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
218
Фермент
ДHK SV40
Hind III
Акриламид
ДНК фага λ
Eco RI
Агароза
Сайт узнавания и разрезания
но другого на один нуклеотид. В результате образуются фрагменты ДНК с одноцепочечными выступами длиной только в один нуклеотидный остаток.
г. Картирование сегментов ДНК
с помощью рестриктирующих
эндонуклеаз типа II
С помощью рестриктирующих эндонуклеаз можно разрезать сложные геномы или длинные сегменты ДНК на воспроизводимые наборы более
мелких единиц. В свою очередь такие единицы можно
разделить по размерам с помощью нескольких методов. Чаще всего для этого используют электрофорез фрагментов ДНК в полужидком геле, приготовленном на основе агарозы или полиакриламида
(рис. 4.10). Обычно подвижность двухцепочечного
фрагмента в электрическом поле обратно пропорциональна логарифму его размера. Используя в качестве маркеров фрагменты известной длины, легко
определить размер интересующего нас фрагмента
с помощью линейки и простого графика. Для проведения такого анализа обычно достаточно менее
1 мкг ДНК, поскольку фрагменты легко выявляются при окрашивании соответствующим красителем,
например бромистым этидием.
Набор фрагментов, получающихся при расщеплении ДНК определенной рестриктирующей эндонуклеазой, является своеобразным «отпечатком
пальцев» этой ДНК. Определяя, какие фрагменты
образуются при расщеплении ДНК несколькими
рестриктазами по отдельности и в разных комбинациях, часто удается установить порядок расположения сегментов в исходной молекуле, т.е. построить физическую карту ДНК, где указано положение каждого сегмента (рис. 4.11). Сложные геномы или большие молекулы ДНК дают при обработке рестриктирующими эндонуклеазами сложные
наборы фрагментов, и для их анализа используют
специальные компьютерные программы.
Размер (п.н.)
Группа рестриктирующих эндонуклеаз типа II, разрезающих цепи ДНК на определенном расстоянии от узнаваемой последовательности.
Размер (т.п.н.)
РИС. 4.9.
Размер (т.п.н.)
Mbo II
Размер (п.н.)
Hph I
А
Б
РИС. 4.10.
Электрофоретическое разделение фрагментов ДНК,
получающихся при гидролизе последней рестриктирующими эндонуклеазами. А. Электрофорез в агарозном
геле смеси фрагментов, образующихся при гидролизе
ДНК бактериофага λ ферментом Eco RI. Б. Электрофорез в полиакриламидном геле смеси фрагментов, образующихся в результате гидролиза ДНК SV40 эндонуклеазой Hind III. В агарозном геле разделяют относительно крупные фрагменты (23-0,3 т.п.н.), а в полиакриламидном - более мелкие (6 т.п.н. - 2 п.н.). Варьируя
процентное содержание агарозы или акриламида в геле,
можно оптимизировать разделение фрагментов в том
или ином диапазоне длин. Для визуализации полос,
содержащих фрагменты разной длины, гель окрашивают бромистым этидием. В ультрафиолетовом свете
различимы полосы, содержащие всего 50 нг ДНК. Под
каждой из диаграмм приведены графики зависимости
относительной подвижности фрагментов от логарифма
их размеров.
д. Защита ДНК посредством
метилирования
Родственные метилазы. Геномы бактерий, кодирующие рестриктирующие эндонуклеазы, защищены от самодеградации с помощью специфических
систем модификации. Метилазы, осуществляющие
специфическую модификацию, узнают те же нуклео-
219
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
Hindlll
BamHI
EcoRI
EcoRI
+
HindIII
EcoRI BamHI
+
+
BamHI HindIII
рестрикции в ДНК проявляют устойчивость к
действию определенных эндонуклеаз. Например, в
ДНК позвоночных часто встречаются динуклеотиды 5'-meCG-3' (разд. 1.1.а). Если сайт рестрикции
эндонуклеазы Hpa II содержит такой метилированный динуклеотид, то фермент не может разрезать
ДНК в этом месте (рис. 4.13). Этот факт используется для определения в сложных геномах состояния метилирования таких динуклеотидов 5'-CG-3',
которые находятся в сайтах узнавания Hpa II. Несмотря на неспособность эндонуклеазы Hpa II разрезать динуклеотид 5'-CmeCGG-3', ее изошизомер,
эндонуклеаза Msp I, осуществляет такое разрезание
(рис. 4.13). Сравнивая чувствительность фрагментов
ДНК к двум указанным ферментам, можно лоРодственные
сайты
метилирования
Sam HI
РИС. 4.11.
Построение рестрикционной карты кольцевой молекулы
ДНК длиной 12 т.п.н. ДНК гидролизовали указанными
эндонуклеазами по отдельности или в разных комбинациях и определяли размер фрагментов (в т.п.н.) с помощью электрофореза в агарозном геле. Зная размер
фрагментов, можно установить положение сайтов узнавания для трех представленных ферментов.
тидные последовательности, что и родственные им
эндонуклеазы, и переносят метильную группу от
S-аденозилметионина к специфическому адениновому (с образованием N6-метиладенина) или цитозиновому (с образованием 5-метилцитозина) остаткам
в пределах сайта узнавания (рис. 1.4). В результате
эндонуклеазное разрезание блокируется. На рис. II.17
представлены основные типы соответствующих реакций, а на рис. 4.12 – характерные сайты метилирования для нескольких систем типа II. Некоторые
метилазы достаточно хорошо очищены и могут
использоваться при конструировании рекомбинантных молекул ДНК (разд. 6.2.б). Метилирование
цепей, как и разрезание эндонуклеазами, происходит
симметрично. Однако метилазы, которые были изучены, включая фермент Eco RI,– это мономерные
белки, и метилирование разных цепей осуществляется в два отдельных этапа. Таким образом, несмотря на то, что эндонуклеазы и метилазы типа
II узнают одну и ту же короткую последовательность ДНК и, по-видимому, эволюционировали параллельно, это разные белки.
Идентификация метилированных сайтов в ДНК.
Метилирование – это весьма распространенное явление, совсем не обязательно связанное с рестрикцией-модификацией. В результате некоторые сайты
Рестриктирующая
эндонуклеаза
Eco RI
Eco RII
Hae III
Hind III
Hpa l
Hpa ll
РИС. 4.12.
Родственные сайты метилирования некоторых систем
рестрикции-модификации.
220
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
HpaII
MspI
Клонирование
в Е. соli
HpaII
или
MspI
Направление
миграции
РИС. 4.13.
Дифференцированное действие Msp I и Нра II на частично метилированный сегмент ДНК. После того как
данный сегмент был клонирован и реплицирован в Е.
соli, оба фермента дали одинаковый набор фрагментов,
поскольку 5-метилцитозин был замещен цитозином.
Внизу схематически представлены результаты гельэлектрофореза смеси фрагментов ДНК, полученных
после гидролиза в каждом из трех случаев.
кализовать метилированный цитозин на карте. Подобным же образом часто встречающуюся в ДНК
растений
последовательность
5'-СmеСTAGG-3'
можно отличить от неметилированной формы,
5'-ССTAGG-3', если сравнить продукты, получающиеся при расщеплении ДНК с помощью изошизомеров Bst NI и Eco RII (рис. 4.14).
Независимые метилазы E. coli. При включении
фрагментов эукариотической ДНК в бактериальные
векторы и их репликации в клетках Е. coli или других
прокариот характерный для них тип метилирования
утрачивается и они метилируются способом, специфичным для новой клетки-хозяина. Например,
в клетках Е. coli динуклеотиды 5'-CG-3' не метилируются, и в результате сайты, ранее защищенные
от действия эндонуклеазы Hpa II, становятся
чувствительными к ней (рис. 4.13). Однако два
обычных фермента E. coli: dam ДНК-метилтрансфераза, которая метилирует остаток А в последовательности 5'-GATC-3', и dcm ДНК-метилтрансфераза, метилирующая остаток С в последовательности 5'-ССTAGG-3',– образуют новые устойчивые
сайты; ни одна из этих метилаз не является частью
системы рестрикции-модификации. Кроме того,
эукариотическая ДНК, реплицированная в E. coli,
становится устойчивой к эндонуклеазам Mbo I и
Bcl I благодаря тому, что в пределах их сайтов
узнавания находится 6-метиладенин. Заметим, что
тот же самый 6-метиладенин в сайте 5'-GATC-3' не
мешает работе эндонуклеаз Bam HI, Bgl I или Sau 3А;
однако разрезание с помощью Sau 3А блокируется,
если метилирован остаток С.
221
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
Сайт
Нет
разрезания
Полинуклеотидкиназа
НраII
2АТР
2ADP
SmaI
РИС. 4.16.
Присоединение 5'-концевых фосфомоноэфирных групп
с помощью полинуклеотидкиназы. В этих опытах ис32
пользуется Р-меченная АТР, в результате чего образуется радиоактивно меченная ДНК.
BstNI
РИС. 4.14.
Пары рестриктирующих эндонуклеаз, с помощью которых можно определить локализацию остатков 5-метилцитозина.
4.3. ФОСФОМОНОЭСТЕРАЗЫ
Часто при проведении экспериментов с рекомбинантными ДНК или при анализе структуры ДНК
приходится отщеплять концевые фосфомоноэфирные группы (рис. 4.15). Известно множество неспецифических фосфомоноэстераз (фосфатаз). Эти ферменты, выделенные из клеток Е. coli и кишечника
теленка, были получены в высокоочищенном виде.
Фосфатазы гидролизуют как 5'-, так и 3'-концевые
фосфомоноэфиры в ДНК и РНК.
Фосфомоноэфирные группы, находящиеся на
конце одноцепочечных разрывов в дуплексной ДНК
или экранированные нависающей над ними второй
цепью, подобные тем, которые образуются при
разрезании эндонуклеазой Pst I (рис. 4.7), удаляются
с помощью фосфатазы только при слабоденатурирующих условиях (например, при повышенной
температуре).
4.4. ПОЛИНУКЛЕОТИДКИНАЗА
Киназы составляют большой класс ферментов,
катализирующих фосфорилирование многих биохимических соединений – от небольших молекул до
очень крупных макромолекул, включая полипептиды и полинуклеотиды.
Полинуклеотидкиназа (рис. 4.16), широко используемая в качестве реактива в экспериментах
с рекомбинантными ДНК, была выделена и очищена из клеток E. coli, инфицированных бактериофагом Т4. Фермент кодируется геномом бактериофага.
Донором фосфата служит АТР, а одним из продуктов реакции является ADP. В ходе реакции
специфически фосфорилируются 5'-концевые гидроксильные группы молекул ДНК и РНК; 3'-концевые гидроксильные группы не фосфорилируются.
Одной из важных сфер применения полинуклеотидкиназы является мечение 5'-конца полинуклеотидной цепи с помощью радиоактивного 32Р с использованием АТР, меченной по γ-фосфату. Последовательное действие фосфатазы (разд. 4.3) и полинуклеотидкиназы приводит к замещению немеченого
5'-концевого фосфомоноэфира на радиоактивный
без каких-либо других изменений в цепи.
РИС. 4.15.
Гидролиз концевых фосфодиэфирных групп с помощью фосфатазы.
Слабо денатурирующие условия
Стандартные условия
Фосфомоноэстераза
222
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
4.5. ДНК-ЛИГАЗА
Получение рекомбинантных молекул ДНК
включает объединение in vitro сегментов ДНК из
различных источников. Благодаря тому что при
расщеплении ДНК определенными эндонуклеазами
образуются фрагменты с липкими концами, при
отжиге эти фрагменты довольно легко соединяются,
однако водородные связи, удерживающие их вместе,
в обычных условиях оказываются относительно слабыми и легко разрушаются. Для ковалентного сшивания фрагментов используют ДНК-лигазу, которая катализирует образование фосфодиэфирных
связей между соседними нуклеотидами (разд. 2.1.д).
Механизм лигирования представлен на рис. 2.20.
Чтобы лигирование было успешным, в объединяемых цепях должен произойти отжиг комплементарных («липких») концов; в этом случае происходит лигирование обеих цепей (рис. 4.17, А). Если два
одноцепочечных сегмента удерживаются рядом за
счет образования водородных связей с интактной
комплементарной цепью, то образование фосфодиэфирной связи происходит только в одной цепи
(рис. 4.17, Б). ДНК-лигаза фага Т4 (но не лигаза
Е. coli) способна также соединить двухцепочечные
молекулы с тупыми концами (хотя и с низкой
эффективностью), катализируя образование фосфодиэфирных связей в обеих цепях (рис. 4.17, B).
4.6. ДНК-ПОЛИМЕРАЗА I
Лигаза фага T4
или Е. соli
А
Лигаза фага Т4
или Е. coli
Б
+
Лигаза фага Т4
В
РИС. 4.17.
A. Ковалентное сшивание липких концов двухцепочечных молекул с помощью ДНК-лигазы. Б. Лигаза катализирует образование фосфодиэфирных связей в месте
одноцепочечного разрыва в двухцепочечной молекуле.
B. ДНК-лигаза фага Т4 сшивает двухцепочечные молекулы с тупыми концами.
а. Полифункциональный фермент
Механизм, с помощью которого ДНК-полимераза катализирует полуконсервативный синтез новых цепей ДНК, был описан в разд. 2.1.д. Цепи
удлиняются путем последовательного присоединения нуклеотидов к праймеру со свободной 3'-гидроксильной группой; выбор нуклеотидного остатка
на каждом этапе определяется ДНК-матрицей.
ДНК-полимераза I E. coli катализирует и некоторые
другие важные реакции. Две из них имеют особое
значение для экспериментов с рекомбинантными
ДНК: это 3'–>5'- и 5'–>3'-экзонуклеазные реакции.
В обоих случаях образуются продукты с 5'-фосфомоноэфирными концами. Две указанные экзонуклеазные активности присущи разным участкам молекулы ДНК-полимеразы I, которые можно разделить, обработав белок протеолитическими ферментами. После разделения обнаруживается, что
3'–>5'-экзонуклеазная и полимеразная активности
связаны с большим по размеру полипептидом,
содержащим карбоксильную группу на конце,
а 5'–>3'-экзонуклеазная активность – со вторым, более мелким фрагментом.
б. Ник-трансляция
Реакции, катализируемые ДНК-полимеразой I,
нашли широкое применение. Например, часто используется способность ДНК-полимеразы I катализировать одновременно как полимеризацию, так
и 5'–>3'-экзонуклеазное расщепление (рис. 4.18).
Фермент, выступая в роли экзонуклеазы, осуществляет деградацию цепи в 5'–>3'-направлении, начиная с 5'-конца одноцепочечной бреши (ника) в двухцепочечной ДНК, а выступая в роли полимеразы,
восстанавливает цепь путем последовательного присоединения мононуклеотидных остатков к свобод-
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
223
ДНК-полимераза I
РИС. 4.18.
Ник-трансляция. В результате совместного действия
5'–>3'-экзонуклеазной и полимеразной активностей
ДНК-полимеразы I E. соli в присутствии α-32Р-меченных
дезоксинуклеотидтрифосфатов (на рисунке они заклю-
чены в окрашенный прямоугольник) одноцепочечный
разрыв (ник) в двухцепочечной ДНК перемещается
вдоль молекулы ДНК, при этом синтезируется 32 Р-меченная ДНК.
ной 3'-гидроксильной группе на другом конце бреши.
Собственно синтеза ДНК не происходит: брешь
лишь перемещается вдоль цепи, чем и объясняется
название этого процесса – ник-трансляция. Проводя
ник-трансляцию в присутствии α-32Р-меченных дезоксинуклеозидтрифосфатов, в качестве субстратов
получают меченые фрагменты ДНК с высокой
удельной активностью.
вой фрагмент ДНК-полимеразы I, получаемый
в результате протеолиза; это позволяет избежать
5'–>3'-экзонуклеазного расщепления
матрицы
(разд. 2.1.д). Липкие концы можно превратить в тупые и с помощью специфичной к одноцепочечной
ДНК нуклеазы, однако в этом случае утрачивается
несколько нуклеотидных остатков (рис. 4.2, А).
в. Заполнение брешей
ДНК-полимераза способна превращать фрагменты ДНК с липкими концами во фрагменты
с тупыми концами при наличии выступающего
5'-конца (рис. 4.19). 3'-гидроксильный конец служит
праймером, 5'-выступ – матрицей; пробел на 3'-конце заполняется путем последовательного присоединения дезоксинуклеотидных остатков. Для заполнения лучше использовать большой карбокси-конце-
РИС. 4.19.
Образование тупых концов путем синтеза недостающего участка одной из цепей с помощью большого фрагмента ДНК-полимеразы I.
4.7. РНК-ЗАВИСИМЫЕ
ДНК-ПОЛИМЕРАЗЫ
(обратные транскриптазы)
Эти ферменты были выделены из РНК-содержащих опухолеродных вирусов. Они позволяют
синтезировать ДНК на РНК-матрице in vitro
(разд. 2.2). Реакция, катализируемая обратными
транскриптазами, аналогична стандартным реакциям с участием ДНК-полимераз и, как в случае
с другими ДНК-полимеразами, нуждается в затравке (праймере). В качестве матрицы обычно используется одна цепь РНК, на которой синтезируется
комплементарная цепь ДНК. В результате образуется гибридная молекула РНК–ДНК. Часто
удобным праймером служит короткая цепочка полидезоксириботимидиловой кислоты [poly(dT)], поскольку она способна спариваться с полирибоадениловой кислотой, обычно находящейся на концах
эукариотических мРНК (рис. 4.20) (разд. 3.8.а); в результате такого спаривания инициируется синтез
ДНК-копии этой РНК (кДНК).
224
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
dATP, dGTP, dCTP, dTTP
Обратная транскриптаза
4.8. ТЕРМИНАЛЬНАЯ
ДЕЗОКСИНУКЛЕОТИДИЛТРАНСФЕРАЗА
а. Полимеризация без матрицы
РНКаза Н или щелочь
ДНК-полимераза I или
обратная транскриптаза
dATP, dCTP, dGTP, dTTP
Специфичная в отношении
одноцепочечной ДНК
нуклеаза
РИС. 4.20.
Схематическое изображение реакции, катализируемой
обратной транскриптазой, и синтеза двухцепочечной
кДНК.
кДНК-копия молекулы мРНК может быть превращена в двухцепочечную ДНК. Для этого прежде
всего с помощью РНКазы Н или щелочного гидролиза удаляют исходную матричную РНК. Оставшаяся одноцепочечная кДНК служит собственным
праймером (а также и матрицей) при синтезе второй
комплементарной цепи ДНК. Как это происходит,
не совсем ясно. Последняя реакция может катализироваться либо ДНК-полимеразой I, либо обратной
транскриптазой. По-видимому, праймером служит
короткая шпилечная структура, образующаяся
вблизи 3'-гидроксильного конца первой цепи. Конечный дуплекс все еще содержит шпильку на одном
из концов, которая разрезается специфичной в отношении
одноцепочечной
ДНК
нуклеазой
(см.
рис. 4.2, В) с образованием двух полностью комплементарных цепей ДНК (дуплексная кДНК).
Терминальная
дезоксинуклеотидилтрансфераза
(часто называемая терминальной трансферазой) является в определенном смысле полимеразой, поскольку она катализирует синтез полидезоксирибонуклеотидов из дезоксирибонуклеозидтрифосфатов
с высвобождением неорганического пирофосфата.
Подобно ДНК-полимеразам, она не способна инициировать синтез новой полимерной цепи и поэтому
требует присутствия праймера со свободной концевой 3'-гидроксильной группой. Однако в отличие от
истинных ДНК-полимераз она не нуждается в матрице и не способна что-либо копировать вообще.
Продукт полимеризации соответствует дезоксинуклеозидтрифосфатам, используемым в качестве
субстрата (рис. 4.21). Если в реакции участвует
dATP, то продуктом является полидезоксиадениловая кислота [poly(dА)], находящаяся на 3'-конце
праймера; если используется dGTP, то к праймеру
оказывается присоединенной poly(dG). Поскольку
терминальная дезоксинуклеотидилтрансфераза не
копирует матрицу, продуктом синтеза является одноцепочечный полимер. При использовании в качестве праймера двухцепочечной молекулы на каждом конце дуплекса образуются одинаковые 3'-хвосты. На самом деле терминальная дезоксинуклеотидилтрансфераза предпочитает одноцепочечные, а не
двухцепочечные праймеры. Если имеется полностью
двухцепочечный фрагмент ДНК, к которому нужно
присоединить одноцепочечные хвосты, можно использовать различные методы получения одноцепочечных концов, способных служить праймерами
(рис. 4.22).
б. Синтез липких концов
С помощью дезоксинуклеотидилтрансферазы
к молекулам ДНК, не имеющим липких концов,
можно присоединить такие концы (рис. 4.23). Тупые
Терминальная
дезоксинуклеотидилтрансфераза
РИС. 4.21.
Реакция, катализируемая терминальной дезоксинуклеотидилтрансферазой. N - любой из четырех дезоксинуклеотидов, А, Т, G или С.
225
4. ИНСТРУМЕНТАРИЙ: ФЕРМЕНТЫ
РИС. 4.22.
Экзонуклеаза фага λ
(5' – 3')
Способы получения одноцепочечного праймера, в котором нуждается терминальная дезоксинуклеотидилтрансфераза, на полностью двухцепочечной молекуле ДНК.
Мягкие денатурирующие
условия
Низкая концентрация
солей или ионов Со2+
Терминальная
дезоксинуклеотидилтрансфераза
dTTP
Смешивание и отжиг
Заполнение пробелов
с помощью большого
фрагмента ДНК-полимеразы I
dATP + dTTP
ДНК-лигаза
и
РИС. 4.23.
Образование липких концов с помощью терминальной дезоксинуклеотидилтрансферазы. Конечный продукт - линейная молекула - легко может замкнуться в кольцо.
226
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
концы образуются при механическом разрыве больших молекул ДНК (например, при быстром перемешивании раствора или продавливании его через
узкое отверстие), при обработке ДНК с помощью
рестриктирующих эндонуклеаз, дающих тупые концы, или при действии неспецифических ДНКаз. Например, если к одному набору фрагментов ДНК
присоединить poly(dT), а к другому – poly(dА) и смешать эти фрагменты, то произойдет их соединение
друг с другом. Пробелы, образующиеся из-за неравной длины poly(dT)- и роlу(dА)-хвостов, могут быть
заполнены с помощью ДНК-полимеразы I, а концы
соединены ДНК-лигазой. Такой подход использовался при конструировании первой рекомбинантной
молекулы ДНК. И хотя открытие рестриктирующих
эндонуклеаз сильно упростило процедуру
получения липких концов при рекомбинации моле-
кул ДНК in vitro, иногда для их создания все еще
используется терминальная дезоксинуклеотидилтрансфераза.
4.9. РOLY(А)-ПОЛИМЕРАЗА
Подобно терминальной дезоксинуклеотидилтрансферазе, poly(А)-полимераза присоединяет нуклеотидные остатки к 3'-концу цепи без участия
матрицы. Однако poly(А)-полимераза проявляет
специфичность в отношении РНК. Праймером является полирибонуклеотид, а субстратом – АТР.
При этом GTP, СТР, UTP или dATP не могут
заменить ATP. Poly(А)-полимераза выполняет
высокоспециализированную и важную функцию
в экспериментах с рекомбинантными ДНК: ее используют для присоединения poly(А)-концов к молекулам РНК при синтезе кДНК (разд. 4.7).
Глава 5
ИНСТРУМЕНТАРИЙ:
СИСТЕМЫ ХОЗЯИН–ВЕКТОР
В основе молекулярного клонирования лежит
встраивание нужного фрагмента ДНК (вставки)
в другую молекулу ДНК (вектор), которая способна
реплицироваться в соответствующей клетке-хозяине
(см. рис. II.12). Такое встраивание осуществляется in
vitro, а затем образовавшиеся рекомбинантные молекулы ДНК вводятся в клетки. Векторая молекула
должна содержать точку начала репликации (ori).
Кроме того, для репликации нужны специфические
ферменты и другие белки; их поставляет клеткахозяин или они кодируются самим вектором. Вектором может быть любой небольшой внехромосомный элемент (например, плазмида, ДНК фага или
вируса). Каждый из этих элементов встречается
в природе в клетках определенных видов, и большинство из них реплицируется только в природном
хозяине или клетках близкородственных видов.
В большинстве случаев эволюция механизма репликации протекала в направлении создания оптимальных условий для существования в клетках природного хозяина внехромосомных генетических элементов, при этом использовались метаболиты, ферменты и другие белки клетки-хозяина, а также ее
аппарат белкового синтеза. Поэтому основным
инструментом молекулярного клонирования всегда
является двухкомпонентная система – совместимая
комбинация хозяина и вектора.
При рекомбинации in vitro обычно образуется
популяция молекул ДНК, в которой лишь некоторые имеют нужную структуру. Клонирование
уникальных рекомбинантных молекул должно происходить при соблюдении следующих требований:
1. Условия, при которых популяция рекомбинантных ДНК смешивается с популяцией реципиентных клеток, должны быть такими, чтобы
в каждую клетку попало только по одной рекомбинантной молекуле. Это позволяет изолировать
рекомбинантные молекулы друг от друга.
2. Каждая реципиентная клетка в популяции
должна быть отделена от всех остальных, чтобы
можно было выделить клон клеток или вирусов,
содержащих уникальную рекомбинантную молекулу.
3. Клетки или вирусы, получившие рекомбинантные ДНК, должны отличаться от клеток, их не
получивших, так чтобы их можно было отобрать
либо идентифицировать при скрининге.
4. Клетки, получившие нужную рекомбинантную молекулу, должны отличаться от клеток, содержащих другие рекомбинантные молекулы ДНК,
чтобы можно было отобрать их или идентифицировать при скрининге.
В этой главе мы рассмотрим разнообразные
типичные системы «хозяин-вектор» и первые три
требования, которые имеют к этой теме прямое
отношение, поскольку методы, используемые для
скрининга и селекции, в основном зависят от определенных свойств используемой комбинации «хозяин-вектор». Методы выделения желаемого рекомбинантного клона (требование 4) описаны
в гл. 6. Отобранные нами примеры иллюстрируют
основные принципы, которые применяются в настоящее время при конструировании систем, используемых в сложных экспериментальных ситуациях.
Наиболее широко применяются такие комбинации, когда в роли хозяина выступает штамм
E. coli К12, а в роли вектора – плазмиды и фаги
Е. coli. Предпочтение, отдаваемое этому штамму,
обусловлено тем, что еще задолго до развития
технологии рекомбинантных ДНК он уже широко
использовался при изучении генетики микробов. Его
генетические и физиологические свойства были детально исследованы и в коллекциях имелись многие
хорошо охарактеризованные мутанты этого штамма. Кроме того, в клетках штамма Е. coli K12 могут
реплицироваться многие бактериофаги и плазмиды – потенциально полезные векторы. Знание
свойств этого бактериального штамма и соответствующих векторов и обусловило его преимущественное использование в экспериментах с рекомбинантными ДНК. Были разработаны также другие системы хозяин-вектор, которые сначала применяли
лишь в особых случаях. Например, если ставилась
задача получить в большом количестве белок, кодируемый клонированным геном, имело смысл использовать системы с Bacillus subtilis. С распространением генетических манипуляций на клетки эукариот и в особенности с началом исследования
экспрессии генов в клетках дрожжей, растений и животных появилась необходимость в разработке подходящих эукариотических систем хозяин-вектор.
Вскоре после того как начались работы с реком-
228
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
бинантными ДНК, ряд ученых выразили беспокойство по поводу того, что клетки или вирусы, содержащие вставки «чужеродной» ДНК, могут проявлять неожиданные и даже опасные свойства. Это
стимулировало поиск ослабленных систем хозяинвектор, что уменьшило бы вероятность инфицирования людей, работающих с этими системами,
и других живых организмов. Некоторые природые
или лабораторные варианты штамма E. coli K12 не
способны выживать или широко распространяться
в окружающей среде, поскольку для их развития
необходимы весьма специфические экспериментально создаваемые условия, обычно не встречающиеся
в природе. С помощью классических генетических
методов и технологии рекомбинантных ДНК были
получены варианты штамма E. coli K12 и других
штаммов, что расширило круг применяемых ослабленных хозяев. В одних случаях соображения
о необходимости ограничения работ с рекомбинантными ДНК и требования, предъявляемые к экспериментам с этими ДНК, находились в едином русле.
В других же применение ослабленных штаммов
давало неожиданный импульс развитию техники
экспериментирования. В процессе работы накапливалось все больше данных о необоснованности многих опасений (по крайней мере для большинства
проводимых экспериментов), и требования к применению ослабленных систем хозяин-вектор становились все менее строгими.
5.1. Е. COLI-СИСТЕМЫ:
КЛЕТКИ-ХОЗЯЕВА
а. Разносторонность хозяина
Несмотря на то что штамм E. coli К12 – это
уникальный, отличный от других штамм Е. coli, он
не однороден по своим свойствам и на самом деле
представляет собой семейство родственных бактериальных штаммов, происходящих от одного исходного изолята. Известные в настоящее время
члены этого семейства отличаются друг от друга
мутациями в одном или нескольких генах. Некоторые штаммы E. coli K12 получены с помощью
направленного отбора специфических по фенотипу
клонов, но большинство из них имеют неидентифицированные аллельные особенности. Многие из
этих особенностей несущественны для свойств субклона, используемого в качестве хозяина для рекомбинантных молекул ДНК, однако некоторые
имеют важное значение. Эти последние свойства
клеток-хозяев, которые проявляются в зависимости
от используемого вектора, можно разбить на несколько классов: одни из них имеют отношение
к точной репликации вектора, другие – к успешному
введению рекомбинантных векторов, третьи – к
удобному отбору необходимого типа рекомбинантов.
б. «Гостеприимство» хозяина
Клетки хозяина должны обеспечивать все условия для репликации векторной ДНК и не содержать
элементов, подавляющих репликацию вектора или
мешающих отбору. Так, нельзя использовать клетки, содержащие активную систему рестрикции, поскольку это угрожает целостности рекомбинантных
ДНК, содержащих чувствительные сайты рестрикции. Также неприемлемы клетки, содержащие нормальные dam- и dcm-метилтрансферазы Е. coli, поскольку в этих случаях образуются реплицированные рекомбинантные ДНК, устойчивые к используемым в экспериментах в качестве инструмента
рестриктирующим
эндонуклеазам
(разд. 4.2.е).
Применяя клетки, дефектные в отношении нормальных рекомбинационных функций, можно предотвратить возникновение нежелательных изменений
во вставке.
Проявление других важных свойств клетки-хозяина зависит от того, какой используется вектор –
плазмидный или фаговый. Например, если вектором служит ДНК бактериофага λ, то хозяйские
клетки не должны быть лизогенными по этому фагу,
поскольку такие клетки устойчивы к повторному
заражению, что обусловлено присутствием λ-репрессора – белка cI, который выключает экспрессию
всех генов, необходимых для лизиса (разд. 3.11.е).
Плазмидные векторы обычно содержат маркерные
гены, благодаря которым клетки-хозяева приобретают удобный для отбора фенотип, свидетельствующий о присутствии в них данного вектора.
Поэтому исходные клетки-хозяева не должны иметь
похожего фенотипа. Например, мутантные клетки
Е. coli, нуждающиеся для своего роста в определенной аминокислоте, являются подходящими хозяевами в комбинации с векторами, несущими недостающий ген. Если высеять культуру клеток, из которых
только часть содержит указанный вектор, на среду,
лишенную данной аминокислоты, то колонии будут
образовывать лишь те клетки, которые несут этот
вектор. Точно так же клетки, чувствительные к определенному антибиотику или токсину, можно использовать в комбинации с векторами, несущими
гены устойчивости к этим агентам. Как правило,
в системах с плазмидными векторами не используются клетки-хозяева, наследующие посторонние
плазмиды, поскольку при этом затрудняется очистка рекомбинантных ДНК, которая зависит от физических свойств плазмидной ДНК.
5. ИНСТРУМЕНТАРИЙ: СИСТЕМЫ ХОЗЯИН-ВЕКТОР
в. Доступность хозяина
Проблема введения изолированных молекул
ДНК в живые клетки Е. coli – процесс, называемый
трансфекцией,– была решена эмпирически вскоре
после начала работы с рекомбинантными молекулами ДНК. Было показано, что в присутствии СаСl2
устойчивые клетки становятся проницаемыми для
ДНК и их трансфекция с помощью фаговой или
плазмидной ДНК осуществляется всего за несколько минут. Природа этого высокоэффективного процесса остается малопонятной. Еще более эффективная передача фаговых геномов достигается в том
случае, если они сначала упаковываются в фаговые
частицы in vitro, а затем вводятся в клетку с помощью стандартной процедуры инфицирования
(разд. 5.3). Очень важное требование в этом случае –
способность клеток адсорбировать и реплицировать
бактериофаг, поскольку не все штаммы Е. coli являются пермиссивными хозяевами для всех бактериофагов E. coli.
г. Некоторые примеры
Особые свойства различных вариантов штамма
E. coli К12 лучше всего иллюстрирует рассмотрение
некоторых широко используемых производных этого штамма (табл. 5.1). E. coli K12 С600 является
одним из стандартных производных штамма К12,
хотя различные клоны С600 имеют неодинаковые
генотипы. Субклон RR1 не способен усваивать галактозиды из среды (обозначение lac Y указывает на
отсутствие функциональной β-галактозидпермеазы).
Плазмидный вектор, поставляющий β-галактозидпермеазный ген, сообщает реципиентным клеткам
способность усваивать β-галактозиды, которые затем гидролизуются β-галактозидазой. Это очень
удобный маркер, поскольку успешно трансфицированные клетки образуют голубые колонии на агаре,
содержащем 5-бром-4-хлор-3-индолил-β-D-галактоТаблица 5.1. Некоторые варианты штамма
E. coli K12, широко используемые в качестве
клеток-хозяев
Полезные гены 1)
Вариант
Вектор
С600
RR1
НВ101
χ1776
71-18
DH1 2)
Плазмиды, фаг λ
Плазмиды
lacY, hsd R, end A
»
lac Y, hsd R, end A, rec A
»
dap
Фаг М13
Δ[lac-pro]; F' lac (ΔМ15)
Плазмиды
hsd R, end A, rec A
1)
Эти гены Е. coli описаны в тексте.
Этот штамм особенно эффективно трансфицируется плазмидными векторами.
2)
229
зид (названный Xgal) и их легко идентифицировать.
Голубой хромофор образуется в результате гидролиза Xgal β-галактозидазой. Штамм RR1 несет мутацию hsd R, которая инактивирует эндогенную
рестриктирующую эндонуклеазу Е. coli К12; это сводит к минимуму деградацию поступившей в клетку
плазмидной рекомбинантной ДНК. Дополнительная защита от деградации обусловливается тем, что
в клетках этого штамма отсутствует основная дезоксирибоэндонуклеаза E. coli – end А. Субклон НВ101,
близкий родственник RR1, имеет еще одно преимущество: он не способен к общей рекомбинации
(rec А).
Штамм χ1776 был сконструирован специально
для работы с рекомбинантными ДНК в ответ на
выраженное некоторыми учеными беспокойство
о возможной опасности этих экспериментов. С помощью стандартных генетических методов в ДНК
была внесена мутация (dap), в результате которой
клетки могли синтезировать клеточную стенку только в тех случаях, когда в среду добавляли существенный ее компонент – редкую диаминопимелиновую аминокислоту. Эти и другие мутации, приводящие к повреждению белков, необходимых для
образования клеточной стенки, делают клетки χ1776
очень чувствительными к некоторым антибиотикам
и к лизису солями желчных кислот (в кишечнике
животных) и ионными детергентами. Эта же чувствительность приводит к необходимости использовать специальные процедуры для проведения успешной трансфекции.
Удобные векторы были сконструированы на основе фага М13 (разд. 5.3), представителя группы так
называемых Ff- (т.е. F-специфичных нитчатых) фагов. Эти фаги инфицируют только те клетки Е. coli,
которые несут половой фактор, называемый F-фактором (см. введение к ч. II). Поэтому хозяином для
фага М13 должен быть штамм F + , каким является
штамм 71-18. У E. coli 71-18 lac-оперон делетирован
(Δ[lac-pro]) из геномной ДНК, но он содержится
в F-плазмиде (F' lас). Для облегчения работы с этим
штаммом F' lac-плазмиду маркируют делецией
(ΔM15), соответствующей N-концу р-галактозидазы. Голубые бляшки, указывающие на присутствие
активной β-галактозидазы, обнаруживаются на агаре с Xgal только в том случае, если вектор М13
содержит область (lac Zα) lac-оперона, отсутствующую в F' lac. Каждый из двух геномов (F' lac [ΔM15]
и М13 lac Zα) детерминирует свою часть молекулы
β-галактозидазы, и в результате их взаимодействия
внутри клетки образуется активная β-галактозидаза.
ЧАСТЬ II. ТРИУМФ РЕКОМБИНАНТНЫХ ДНК
230
Таблица 5.2. Модульная организация плазмид
Плазмиды
(приблизительные размеры в т.п.н.)
Модули
F
(93)
Модуль репликации
со строгим контролем
(1-2 копии)
+
Модуль репликации
с ослабленным контролем (10-30 копий)
–
Модуль конъюгации
+
Модуль резистентности
–
к тетрациклину
–
Соl-модуль
Модуль резистентности
–
к ампициллину
Модуль резистентности
к хлорамфениколу
–
R100
(100)
ColV
+
–
(140)
ColE1 Ар201
(6)
(14)
+
–
–
–
+
+
+
–
–
+
–
–
+
–
–
+
–
+
–
–
–
+
+
–
–
–
5.2. Е. COLI-СИСТЕМЫ:
ПЛАЗМИДНЫЕ ВЕКТОРЫ
а. Модульная структура плазмид
Существует много разных способов классификации плазмид, но, по-видимому, целесообразнее
всего рассмотреть их здесь с точки зрения наличия
в них модульных сегментов ДНК.
В табл. 5.2 суммированы данные о модульных
особенностях нескольких встречающихся в природе
плазмид. Каждый модульный сегмент может содержать один или несколько генов, или цис-действующих элементов,– таких, например, как область
инициации репликации. Функционально родственные модули в различных и независимо выделенных
плазмидах часто, но не всегда оказываются и структурно родственными, как если бы они произошли от
одной ДНК. Каждая плазмида должна иметь по
крайней мере один из нескольких репликационных
модулей, которые позволяют ей автономно реплицироваться. В одном из классов, типичным представителем которого являются F-плазмиды, репликация и сегрегация регулируются согласованно с репликацией бактериального генома, и в каждой клетке
содержится одна или две копии плазмиды. О таком
типе репликации говорят как о репликации со строгим контролем. Второй тип репликационного модуля свободен от такого контроля, что приводит
к существованию в клетке многих копий плазмид.
Подобный тип репликации получил название репликации с ослабленным контролем.
Наличие других модулей, не связанных с репли-
кацией, не является обязательным для каждой определенной плазмиды. Половые факторы, т.е. конъюгативные (или самотрансмиссивные) плазмиды,
подобные F-фактору, имеют модули, содержащие
гены и регуляторные области, необходимые для
переноса плазмиды из одной клетки в другую (см.
введение к ч. II). Половые факторы, несущие модуль
ДНК, полученный от бактериальной хромосомы,
отмечены апострофом, как в случае F'.
Модули другого типа содержат гены, белковые
продукты которых инактивируют антибиотики.
Плазмиды, несущие такие модули, часто называют
R-плазмидами (от англ. resistance – устойчивость;
табл. 5.3). Часто одна плазмида обеспечивает устойчивость к нескольким антибиотикам, при этом
все или несколько генов резистентности разного
типа могут быть сгруппированы в одном модуле.
Не все R-плазмиды способны осуществлять функцию полового фактора, которая зависит от наличия
в плазмиде модуля конъюгации. Неконъюгативные
плазмиды (утратившие модуль конъюгации) не способны к самотрансмиссивности, но некоторые из
них могут быть перенесены из одной клетки в другую, если они совмещены в донорной клетке с половым фактором. Половой фактор осуществляет перенос неконъюгативной плазмиды, которую в этом
случае называют мобилизуемой.
Таблица 5.3. Гены резистентности к антибиотикам
Антибиотик (ген) Кодируемые белки
Ампициллин
Механизм резистентности
β-Лактамаза
Гидролиз связи С—N
в β-лактамном
(пенициллиназа)
кольце
Хлорамфеникол Хлорамфеникол- Ацетилирование САМ
ацетилтрансфес помощью ацетил(cam)
СоА с образованием
раза
О-ацетил-САМ
Охарактеризован Уменьшает способТетрациклин
ность клеток
недостаточно
(tet)
концентрировать
тетрациклин
Стрептомицин СтрептомицинФосфорилирование (1)
или аденилирование
фосфотранс(str)
(2) ОН-группы
фераза (1)
Стрептомицинстрептомицина с
аденилатсинпомощью АТР
тетаза (2)
Канамицин
Канамицин-аце- N-ацетилирование (1)
тилтрансфераза
или О-фосфорили(kan)
рование (2) этих
(1)
Неомицин
Аминогликозидродственных
фосфотрансантибиотиков
(neo)
фераза (2)
(amp)
5. ИНСТРУМЕНТАРИЙ: СИСТЕМЫ ХОЗЯИН-ВЕКТОР
~ 100 т.п.н.
Начало
репликации
Рост в Proteus mirabilis
или
Salmonella typhimurium
RFT
~ 70 т.п.н.
r
~З0т.п.н.
РИС. 5.1.
Схематическое изображение (без соблюдения масштаба) генома типичной конъюгативной R-плазмиды и ее
диссоциации на два независимых репликона: RTFи r-плазмиды. Гены резистентности к антибиотикам и их
продукты охарактеризованы в табл. 5.3. Светлыми овалами обозначены области начала репликации (ori). Точками выделены сегменты, необходимые для конъюгации, а штриховкой - мобильные элементы.
Имеется еще один тип модулей, встречающийся
в составе к